Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog AraR - Clostridia-1

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Arabinose utilization
Effector: Arabinose
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 26 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Clostridium acetobutylicum ATCC 824 14 7
Clostridium beijerincki NCIMB 8052 14 6
Clostridium botulinum A str. ATCC 3502
Clostridium butyricum 5521
Clostridium kluyveri DSM 555
Clostridium novyi NT
Clostridium perfringens ATCC 13124
Clostridium tetani E88
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
araJ
 
Clostridium acetobutylicum ATCC 824
*
Clostridium beijerincki NCIMB 8052

Site:
position = -267
score = 4.90972
sequence = TTTCATGTATGTACAAGTAT

Site:
position = -234
score = 4.85152
sequence = AAAATTGTACATACAATTAT

Gene: Cbei_4464: Predicted arabinose response two-component system sensor histidine kinase
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Predicted arabinose response two-component system sensor histidine kinase
araI
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_4463: Predicted arabinose response two-component system sensor histidine kinase/response regulator hybrid
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Predicted arabinose response two-component system sensor histidine kinase/response regulator hybrid
 
CRON 2.
Cbei_4461
 
Clostridium acetobutylicum ATCC 824
*
Clostridium beijerincki NCIMB 8052

Site:
position = -52
score = 4.9091
sequence = GATGTGGTACGTACATGTTT

Gene: Cbei_4461: Putative arabinose-regulated ABC transport system, ATP-binding protein
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Putative arabinose-regulated ABC transport system, ATP-binding protein
Cbei_4460
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_4460: Putative arabinose-regulated ABC transport system, permease protein
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Putative arabinose-regulated ABC transport system, permease protein
Cbei_4459
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_4459: Putative arabinose-regulated ABC transport system, permease protein
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Putative arabinose-regulated ABC transport system, permease protein
 
CRON 3.
Cbei_4451
 
Clostridium acetobutylicum ATCC 824
*
Clostridium beijerincki NCIMB 8052

Site:
position = -135
score = 4.41148
sequence = ATTGATGTACTTACAAGATA

Site:
position = -310
score = 4.40344
sequence = CATGAAGTACGTACAACATA

Gene: Cbei_4451: hypothetical protein
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
hypothetical protein
araF
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_4450: L-arabinose-binding periplasmic protein precursor AraF (TC 3.A.1.2.2)
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
L-arabinose-binding periplasmic protein precursor AraF (TC 3.A.1.2.2)
araG
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_4449: L-arabinose transport, ATP binding protein
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
L-arabinose transport, ATP binding protein
araH
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_4448: L-arabinose transport system permease protein (TC 3.A.1.2.2)
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
L-arabinose transport system permease protein (TC 3.A.1.2.2)
 
CRON 4.
abf3
*
Clostridium acetobutylicum ATCC 824

Site:
position = -300
score = 4.47139
sequence = ATATTTATACGTGTTAATTT

Site:
position = -228
score = 3.90833
sequence = CATTTTATGGGTATATAATA

Gene: CAC3436: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Alpha-N-arabinofuranosidase (EC 3.2.1.55)
 
CRON 5.
araE
*
Clostridium acetobutylicum ATCC 824

Site:
position = -215
score = 4.64203
sequence = CAATTCATACGTATAAAATC

Site:
position = -182
score = 4.37719
sequence = ACATTTATACACATAAATAT

Gene: CAC1339: Arabinose-proton symporter
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Arabinose-proton symporter
 
CRON 6.
arb43
*
Clostridium acetobutylicum ATCC 824

Site:
position = -201
score = 5.72461
sequence = AAATTTATACGTATAAATTA

Site:
position = -60
score = 5.34058
sequence = TAATATGTACGTATATATTA

Gene: CAC1529: Alpha-L-arabinofuranosidase II precursor (EC 3.2.1.55)
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Alpha-L-arabinofuranosidase II precursor (EC 3.2.1.55)
araT
 
Clostridium acetobutylicum ATCC 824

Gene: CAC1530: putative arabinoside transporter
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
putative arabinoside transporter
 
CRON 7.
ptk
*
Clostridium acetobutylicum ATCC 824

Site:
position = -154
score = 4.58233
sequence = TGACATATGCGTACAAATAT

Site:
position = -186
score = 5.82682
sequence = AAATTTATACGTACAAATTA

Gene: CAC1343: Xylulose-5-phosphate phosphoketolase (EC 4.1.2.9)
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Xylulose-5-phosphate phosphoketolase (EC 4.1.2.9)
 
CRON 8.
araK
*
Clostridium acetobutylicum ATCC 824

Site:
position = -103
score = 4.89418
sequence = AAATAGGTACGTACCATTTT

Site:
position = -72
score = 4.46492
sequence = TGACATGTACGTACAAAAGT

Gene: CAC1344: novel Ribulokinase (EC 2.7.1.16)
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_4452: novel Ribulokinase (EC 2.7.1.16)
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
novel Ribulokinase (EC 2.7.1.16)
araE/xylT
 
Clostridium acetobutylicum ATCC 824

Gene: CAC1345: Arabinose-proton symporter
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Arabinose-proton symporter
araA
 2
Clostridium acetobutylicum ATCC 824

Gene: CAC1342: L-arabinose isomerase (EC 5.3.1.4)

Gene: CAC1346: L-arabinose isomerase (EC 5.3.1.4)
*
Clostridium beijerincki NCIMB 8052

Site:
position = -260
score = 5.07202
sequence = CATCTTGTATGTACAACATT

Site:
position = -227
score = 4.64442
sequence = AAGCTTGTACATACATCAAA

Gene: Cbei_4457: L-arabinose isomerase (EC 5.3.1.4)
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
L-arabinose isomerase (EC 5.3.1.4)
tal
 
Clostridium acetobutylicum ATCC 824

Gene: CAC1347: Transaldolase (EC 2.2.1.2)
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_4454: Transaldolase (EC 2.2.1.2)
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Transaldolase (EC 2.2.1.2)
tkt
 
Clostridium acetobutylicum ATCC 824

Gene: CAC1348: Transketolase (EC 2.2.1.1)
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_4453: Transketolase (EC 2.2.1.1)
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Transketolase (EC 2.2.1.1)
epiA
 
Clostridium acetobutylicum ATCC 824

Gene: CAC1349: L-arabinose-specific 1-epimerase (mutarotase)
*
Clostridium beijerincki NCIMB 8052

Site:
position = -123
score = 4.85152
sequence = ATAATTGTATGTACAATTTT

Site:
position = -90
score = 4.90972
sequence = ATACTTGTACATACATGAAA

Gene: Cbei_4465: L-arabinose-specific 1-epimerase (mutarotase)
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
L-arabinose-specific 1-epimerase (mutarotase)
araR
*
Clostridium acetobutylicum ATCC 824

Site:
position = -246
score = 4.59459
sequence = TAATTTGTACTTATAAATGT

Site:
position = -88
score = 5.32082
sequence = AAATTTATACGTATCAATAT

Site:
position = -215
score = 4.65115
sequence = ATTTTCATACGTATAAATTC

Gene: CAC1340: Transcriptional repressor of arabinoside utilization operon, GntR family
*
Clostridium beijerincki NCIMB 8052

Site:
position = -99
score = 4.45698
sequence = CATCAAGTGCGTACAACTTT

Gene: Cbei_4456: Transcriptional repressor of arabinoside utilization operon, GntR family
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Transcriptional repressor of arabinoside utilization operon, GntR family
araD
*
Clostridium acetobutylicum ATCC 824

Site:
position = -430
score = 5.32082
sequence = ATATTGATACGTATAAATTT

Site:
position = -272
score = 4.59459
sequence = ACATTTATAAGTACAAATTA

Site:
position = -303
score = 4.65115
sequence = GAATTTATACGTATGAAAAT

Gene: CAC1341: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_4455: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD