Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog FruR2 - Rhodospirillales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Fructose utilization
Effector: Fructose-1-phosphate
Phylum: Proteobacteria/Alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Acetobacter pasteurianus IFO 3283-01
Azospirillum sp. B510 4 2
Gluconacetobacter diazotrophicus PAl 5
Gluconobacter oxydans 621H
Granulibacter bethesdensis CGDNIH1 4 2
Magnetospirillum magneticum AMB-1
Magnetospirillum magnetotacticum MS-1
Rhodospirillum centenum SW
Rhodospirillum rubrum ATCC 11170 4 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
fruR2
 
Acetobacter pasteurianus IFO 3283-01
*
Azospirillum sp. B510

Site:
position = -218
score = 5.15512
sequence = AAGTGAAAACGATTACAGTG

Site:
position = -106
score = 5.21953
sequence = GATTGGAAACGTTTTCAGAT

Gene: AZL_c02640: Transcriptional regulator of fructose utilization, LacI family
 
Gluconacetobacter diazotrophicus PAl 5
 
Gluconobacter oxydans 621H
*
Granulibacter bethesdensis CGDNIH1

Site:
position = -153
score = 5.04852
sequence = ATATGAAAACGTTTTCACAG

Gene: GbCGDNIH1_0413: Transcriptional regulator of fructose utilization, LacI family
 
Magnetospirillum magneticum AMB-1
 
Magnetospirillum magnetotacticum MS-1
 
Rhodospirillum centenum SW
*
Rhodospirillum rubrum ATCC 11170

Site:
position = -106
score = 5.39204
sequence = GAGTGAAAACGATTTCACAA

Gene: Rru_A1973: Transcriptional regulator of fructose utilization, LacI family
Transcriptional regulator of fructose utilization, LacI family
 
CRON 2.
fruB
 
Acetobacter pasteurianus IFO 3283-01
*
Azospirillum sp. B510

Site:
position = -175
score = 5.21953
sequence = ATCTGAAAACGTTTCCAATC

Site:
position = -63
score = 5.15512
sequence = CACTGTAATCGTTTTCACTT

Gene: AZL_c02630: PTS system, fructose-specific IIA component (EC 2.7.1.69) / Phosphotransferase system, phosphocarrier protein HPr / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
 
Gluconacetobacter diazotrophicus PAl 5
 
Gluconobacter oxydans 621H
*
Granulibacter bethesdensis CGDNIH1

Site:
position = -55
score = 5.04852
sequence = CTGTGAAAACGTTTTCATAT

Gene: GbCGDNIH1_0412: PTS system, fructose-specific IIA component (EC 2.7.1.69) / Phosphotransferase system, phosphocarrier protein HPr / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
 
Magnetospirillum magneticum AMB-1
 
Magnetospirillum magnetotacticum MS-1
 
Rhodospirillum centenum SW
*
Rhodospirillum rubrum ATCC 11170

Site:
position = -142
score = 5.39204
sequence = TTGTGAAATCGTTTTCACTC

Gene: Rru_A1972: PTS system, fructose-specific IIA component (EC 2.7.1.69) / Phosphotransferase system, phosphocarrier protein HPr / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
PTS system, fructose-specific IIA component (EC 2.7.1.69) / Phosphotransferase system, phosphocarrier protein HPr / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
fruK
 
Acetobacter pasteurianus IFO 3283-01
 
Azospirillum sp. B510

Gene: AZL_c02620: 1-phosphofructokinase (EC 2.7.1.56)
 
Gluconacetobacter diazotrophicus PAl 5
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1

Gene: GbCGDNIH1_0411: 1-phosphofructokinase (EC 2.7.1.56)
 
Magnetospirillum magneticum AMB-1
 
Magnetospirillum magnetotacticum MS-1
 
Rhodospirillum centenum SW
 
Rhodospirillum rubrum ATCC 11170

Gene: Rru_A1971: 1-phosphofructokinase (EC 2.7.1.56)
1-phosphofructokinase (EC 2.7.1.56)
fruA
 
Acetobacter pasteurianus IFO 3283-01
 
Azospirillum sp. B510

Gene: AZL_c02610: PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69)
 
Gluconacetobacter diazotrophicus PAl 5
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1

Gene: GbCGDNIH1_0410: PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69)
 
Magnetospirillum magneticum AMB-1
 
Magnetospirillum magnetotacticum MS-1
 
Rhodospirillum centenum SW
 
Rhodospirillum rubrum ATCC 11170

Gene: Rru_A1970: PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69)
PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD