Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PaaR - Various betaproteobacteria

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Phylum: Proteobacteria/Beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Methylobacillus flagellatus KT
Methylophilales bacterium HTCC2181
Methylotenera mobilis JLW8
Nitrosomonas europaea ATCC 19718
Nitrosospira multiformis ATCC 25196
Thiobacillus denitrificans
Azoarcus sp. EbN1 12 2
Dechloromonas aromatica RCB
Thauera sp. MZ1T 2 2
Chromobacterium violaceum ATCC 12472
Laribacter hongkongensis HLHK9
Neisseria meningitidis MC58
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
paaG
 
Methylobacillus flagellatus KT
 
Methylophilales bacterium HTCC2181
 
Methylotenera mobilis JLW8
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
*
Azoarcus sp. EbN1

Site:
position = -115
score = 5.5897
sequence = ATTGATTGACCGGTCGGTCAAA

Gene: ebA3542: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Dechloromonas aromatica RCB

Gene: Daro_0371: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Thauera sp. MZ1T

Gene: Tmz1t_1512: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Chromobacterium violaceum ATCC 12472
 
Laribacter hongkongensis HLHK9
 
Neisseria meningitidis MC58
Enoyl-CoA hydratase (EC 4.2.1.17)
paaH
 
Methylobacillus flagellatus KT
 
Methylophilales bacterium HTCC2181
 
Methylotenera mobilis JLW8
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Azoarcus sp. EbN1

Gene: ebA3543: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
 
Dechloromonas aromatica RCB

Gene: Daro_0372: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
 
Thauera sp. MZ1T

Gene: Tmz1t_1511: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
 
Chromobacterium violaceum ATCC 12472
 
Laribacter hongkongensis HLHK9
 
Neisseria meningitidis MC58
3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
paaI
 
Methylobacillus flagellatus KT
 
Methylophilales bacterium HTCC2181
 
Methylotenera mobilis JLW8
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Azoarcus sp. EbN1

Gene: ebA3544: Phenylacetic acid degradation protein paaI
 
Dechloromonas aromatica RCB

Gene: Daro_0373: Phenylacetic acid degradation protein paaI
 
Thauera sp. MZ1T

Gene: Tmz1t_1510: Phenylacetic acid degradation protein paaI
 
Chromobacterium violaceum ATCC 12472
 
Laribacter hongkongensis HLHK9
 
Neisseria meningitidis MC58
Phenylacetic acid degradation protein paaI
paaK
 
Methylobacillus flagellatus KT
 
Methylophilales bacterium HTCC2181
 
Methylotenera mobilis JLW8
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Azoarcus sp. EbN1

Gene: ebA3545: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Dechloromonas aromatica RCB

Gene: Daro_0374: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Thauera sp. MZ1T

Gene: Tmz1t_1509: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Chromobacterium violaceum ATCC 12472
 
Laribacter hongkongensis HLHK9
 
Neisseria meningitidis MC58
Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
paaA
 
Methylobacillus flagellatus KT
 
Methylophilales bacterium HTCC2181
 
Methylotenera mobilis JLW8
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Azoarcus sp. EbN1

Gene: ebA3547: Phenylacetate-CoA oxygenase, PaaA subunit
 
Dechloromonas aromatica RCB

Gene: Daro_0377: Phenylacetate-CoA oxygenase, PaaA subunit
 
Thauera sp. MZ1T

Gene: Tmz1t_1506: Phenylacetate-CoA oxygenase, PaaA subunit
 
Chromobacterium violaceum ATCC 12472
 
Laribacter hongkongensis HLHK9
 
Neisseria meningitidis MC58
Phenylacetate-CoA oxygenase, PaaA subunit
paaB
 
Methylobacillus flagellatus KT
 
Methylophilales bacterium HTCC2181
 
Methylotenera mobilis JLW8
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Azoarcus sp. EbN1

Gene: ebA3548: Phenylacetate-CoA oxygenase, PaaB subunit
 
Dechloromonas aromatica RCB

Gene: Daro_0378: Phenylacetate-CoA oxygenase, PaaB subunit
 
Thauera sp. MZ1T

Gene: Tmz1t_1505: Phenylacetate-CoA oxygenase, PaaB subunit
 
Chromobacterium violaceum ATCC 12472
 
Laribacter hongkongensis HLHK9
 
Neisseria meningitidis MC58
Phenylacetate-CoA oxygenase, PaaB subunit
paaC
 
Methylobacillus flagellatus KT
 
Methylophilales bacterium HTCC2181
 
Methylotenera mobilis JLW8
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Azoarcus sp. EbN1

Gene: ebA3550: Phenylacetate-CoA oxygenase, PaaC subunit
 
Dechloromonas aromatica RCB

Gene: Daro_0379: Phenylacetate-CoA oxygenase, PaaC subunit
 
Thauera sp. MZ1T

Gene: Tmz1t_1504: Phenylacetate-CoA oxygenase, PaaC subunit
 
Chromobacterium violaceum ATCC 12472
 
Laribacter hongkongensis HLHK9
 
Neisseria meningitidis MC58
Phenylacetate-CoA oxygenase, PaaC subunit
paaD
 
Methylobacillus flagellatus KT
 
Methylophilales bacterium HTCC2181
 
Methylotenera mobilis JLW8
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Azoarcus sp. EbN1

Gene: ebA3551: Phenylacetate-CoA oxygenase, PaaD subunit
 
Dechloromonas aromatica RCB

Gene: Daro_0380: Phenylacetate-CoA oxygenase, PaaD subunit
 
Thauera sp. MZ1T

Gene: Tmz1t_1503: Phenylacetate-CoA oxygenase, PaaD subunit
 
Chromobacterium violaceum ATCC 12472
 
Laribacter hongkongensis HLHK9
 
Neisseria meningitidis MC58
Phenylacetate-CoA oxygenase, PaaD subunit
paaE
 
Methylobacillus flagellatus KT
 
Methylophilales bacterium HTCC2181
 
Methylotenera mobilis JLW8
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Azoarcus sp. EbN1

Gene: ebA3553: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Dechloromonas aromatica RCB

Gene: Daro_0381: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Thauera sp. MZ1T

Gene: Tmz1t_1502: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Chromobacterium violaceum ATCC 12472
 
Laribacter hongkongensis HLHK9
 
Neisseria meningitidis MC58
Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
paaR
 
Methylobacillus flagellatus KT
 
Methylophilales bacterium HTCC2181
 
Methylotenera mobilis JLW8
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Azoarcus sp. EbN1

Gene: ebA3555: Transcriptional regulator of phenylacetic acid degradation, TetR family
 
Dechloromonas aromatica RCB
*
Thauera sp. MZ1T

Site:
position = -241
score = 5.45012
sequence = ATTGATCGACTGGTTGGTCGGA

Gene: Tmz1t_2997: Transcriptional regulator of phenylacetic acid degradation, TetR family
 
Chromobacterium violaceum ATCC 12472
 
Laribacter hongkongensis HLHK9
 
Neisseria meningitidis MC58
Transcriptional regulator of phenylacetic acid degradation, TetR family
paaZ
 
Methylobacillus flagellatus KT
 
Methylophilales bacterium HTCC2181
 
Methylotenera mobilis JLW8
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
*
Azoarcus sp. EbN1

Site:
position = -150
score = 5.49437
sequence = TTTGACCGACCGGTCAATCAAT

Gene: ebA3541: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
 
Dechloromonas aromatica RCB

Gene: Daro_0370: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
 
Thauera sp. MZ1T

Gene: Tmz1t_1513: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
 
Chromobacterium violaceum ATCC 12472
 
Laribacter hongkongensis HLHK9
 
Neisseria meningitidis MC58
Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
paaY2
 
Methylobacillus flagellatus KT
 
Methylophilales bacterium HTCC2181
 
Methylotenera mobilis JLW8
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Azoarcus sp. EbN1

Gene: ebA3540: Phenylacetic acid degradation protein PaaY
 
Dechloromonas aromatica RCB
*
Thauera sp. MZ1T

Site:
position = -236
score = 5.20824
sequence = TCCGACCAACCAGTCGATCAAT

Gene: Tmz1t_2998: Phenylacetic acid degradation protein PaaY
 
Chromobacterium violaceum ATCC 12472
 
Laribacter hongkongensis HLHK9
 
Neisseria meningitidis MC58
Phenylacetic acid degradation protein PaaY
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD