Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Phr - Methanosarcinales

Properties
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Heat shock response
Effector:
Phylum: Euryarchaeota
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Methanococcoides burtonii DSM 6242
Methanohalophilus mahii DSM 5219
Methanosaeta thermophila PT 2 1
Methanosarcina acetivorans C2A 4 1
Methanosarcina barkeri str. fusaro 4 1
Methanosarcina mazei Goe1 4 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
phr
 
Methanococcoides burtonii DSM 6242
 
Methanohalophilus mahii DSM 5219
*
Methanosaeta thermophila PT

Site:
position = -56
score = 5.52978
sequence = ATATCTAACTTTTTGTTACTAAC

Site:
position = -42
score = 4.99456
sequence = GTTACTAACCATCAGTTATGATT

Gene: Mthe_0612: Heat shock response regulator Phr, ArsR family
*
Methanosarcina acetivorans C2A

Site:
position = -315
score = 6.21732
sequence = ATTGCTAACTAATGGTTACTAAC

Gene: MA4576: Heat shock response regulator Phr, ArsR family
*
Methanosarcina barkeri str. fusaro

Site:
position = -189
score = 5.90585
sequence = GATGCTAACTATAGGTTACTATC

Gene: Mbar_A0909: Heat shock response regulator Phr, ArsR family
*
Methanosarcina mazei Goe1

Site:
position = -299
score = 5.74626
sequence = ACCGCTAACTAATGGTTACTAAC

Gene: MM1257: Heat shock response regulator Phr, ArsR family
Heat shock response regulator Phr, ArsR family
vat
 
Methanococcoides burtonii DSM 6242

Gene: Mbur_1677: ATPase, AAA+ family
 
Methanohalophilus mahii DSM 5219
 
Methanosaeta thermophila PT

Gene: Mthe_0613: ATPase, AAA+ family
 
Methanosarcina acetivorans C2A

Gene: MA4575: ATPase, AAA+ family
 
Methanosarcina barkeri str. fusaro

Gene: Mbar_A0908: ATPase, AAA+ family
 
Methanosarcina mazei Goe1

Gene: MM1256: ATPase, AAA+ family
ATPase, AAA+ family
hsp20
 
Methanococcoides burtonii DSM 6242
 
Methanohalophilus mahii DSM 5219
 
Methanosaeta thermophila PT
 
Methanosarcina acetivorans C2A

Gene: MA4574: Small heat shock protein 20
 
Methanosarcina barkeri str. fusaro

Gene: Mbar_A0907: Small heat shock protein 20
 
Methanosarcina mazei Goe1

Gene: MM1255: Small heat shock protein 20
Small heat shock protein 20
hsp20
 
Methanococcoides burtonii DSM 6242
 
Methanohalophilus mahii DSM 5219
 
Methanosaeta thermophila PT
 
Methanosarcina acetivorans C2A

Gene: MA4573: Small heat shock protein 20
 
Methanosarcina barkeri str. fusaro

Gene: Mbar_A0906: Small heat shock protein 20
 
Methanosarcina mazei Goe1

Gene: MM1254: Small heat shock protein 20
Small heat shock protein 20
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD