Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog RbkR - Halobacteriales

Properties
Regulator type: Transcription factor
Regulator family: [Other]
Regulation mode:
Biological process: Riboflavin biosynthesis
Effector: Flavin mononucleotide
Phylum: Euryarchaeota
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Haloarcula marismortui ATCC 43049 2 1
Halobacterium salinarum R1 2 1
Halobacterium sp. NRC-1 2 1
Haloferax volcanii DS2 2 1
Halomicrobium mukohataei DSM 12286 2 1
Haloquadratum walsbyi DSM 16790 2 1
Halorhabdus utahensis DSM 12940
Halorubrum lacusprofundi ATCC 49239 2 1
Haloterrigena turkmenica DSM 5511 2 1
Natrialba magadii ATCC 43099 2 1
Natronomonas pharaonis DSM 2160 2 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
rbkR
*
Haloarcula marismortui ATCC 43049

Site:
position = 215
score = 5.60095
sequence = GCATTCCACCTTCGGTATGC

Site:
position = 197
score = 4.60907
sequence = CCGTTCCAAAAGTGGAATGC

Gene: rrnAC3074: DNA-binding HTH domain in riboflavin kinase / CTP-dependent archaeal riboflavin kinase
*
Halobacterium salinarum R1

Site:
position = -49
score = 5.20499
sequence = GCATTCCACTTTCGGTATCC

Gene: OE3964R: DNA-binding HTH domain in riboflavin kinase / CTP-dependent archaeal riboflavin kinase
*
Halobacterium sp. NRC-1

Site:
position = -22
score = 5.20499
sequence = GCATTCCACTTTCGGTATCC

Gene: VNG2126C: DNA-binding HTH domain in riboflavin kinase / CTP-dependent archaeal riboflavin kinase
*
Haloferax volcanii DS2

Site:
position = -49
score = 4.92893
sequence = GCATTCCACTTACGATACGC

Gene: HVO_0326: DNA-binding HTH domain in riboflavin kinase / CTP-dependent archaeal riboflavin kinase
*
Halomicrobium mukohataei DSM 12286

Site:
position = -49
score = 5.01222
sequence = GGATGACACATTCGTTATCC

Gene: Hmuk_1112: DNA-binding HTH domain in riboflavin kinase / CTP-dependent archaeal riboflavin kinase
*
Haloquadratum walsbyi DSM 16790

Site:
position = -49
score = 4.87723
sequence = GCATTCCATGTTCGTTATTC

Gene: HQ3236A: DNA-binding HTH domain in riboflavin kinase / CTP-dependent archaeal riboflavin kinase
 
Halorhabdus utahensis DSM 12940
*
Halorubrum lacusprofundi ATCC 49239

Site:
position = -67
score = 4.30568
sequence = GGTTAACGTTTTTGGGATGC

Site:
position = -49
score = 4.88892
sequence = GCATCTCACATCCGTTACTC

Gene: Hlac_0355: DNA-binding HTH domain in riboflavin kinase / CTP-dependent archaeal riboflavin kinase
*
Haloterrigena turkmenica DSM 5511

Site:
position = -67
score = 4.54427
sequence = CCATCACAGTTTTGGTACGC

Site:
position = -49
score = 6.03131
sequence = GCATGCCACATTCGGTATGC

Gene: Htur_2982: DNA-binding HTH domain in riboflavin kinase / CTP-dependent archaeal riboflavin kinase
*
Natrialba magadii ATCC 43099

Site:
position = -67
score = 4.39929
sequence = CCATAACAGTTCTGTGATGC

Site:
position = -49
score = 5.76313
sequence = GCGTACCACATTCGGTACGC

Gene: Nmag_0941: DNA-binding HTH domain in riboflavin kinase / CTP-dependent archaeal riboflavin kinase
*
Natronomonas pharaonis DSM 2160

Site:
position = -49
score = 5.00593
sequence = CCATACCACATTCGTTACGG

Gene: NP0072A: DNA-binding HTH domain in riboflavin kinase / CTP-dependent archaeal riboflavin kinase
DNA-binding HTH domain in riboflavin kinase / CTP-dependent archaeal riboflavin kinase
ribB
 
Haloarcula marismortui ATCC 43049

Gene: rrnAC3073: 3,4-dihydroxy-2-butanone 4-phosphate synthase
 
Halobacterium salinarum R1

Gene: OE3963R: 3,4-dihydroxy-2-butanone 4-phosphate synthase
 
Halobacterium sp. NRC-1

Gene: VNG2125Gm: 3,4-dihydroxy-2-butanone 4-phosphate synthase
 
Haloferax volcanii DS2

Gene: HVO_0327: 3,4-dihydroxy-2-butanone 4-phosphate synthase
 
Halomicrobium mukohataei DSM 12286

Gene: Hmuk_1111: 3,4-dihydroxy-2-butanone 4-phosphate synthase
 
Haloquadratum walsbyi DSM 16790

Gene: HQ3235A: 3,4-dihydroxy-2-butanone 4-phosphate synthase
 
Halorhabdus utahensis DSM 12940
 
Halorubrum lacusprofundi ATCC 49239

Gene: Hlac_0354: 3,4-dihydroxy-2-butanone 4-phosphate synthase
 
Haloterrigena turkmenica DSM 5511

Gene: Htur_2983: 3,4-dihydroxy-2-butanone 4-phosphate synthase
 
Natrialba magadii ATCC 43099

Gene: Nmag_0942: 3,4-dihydroxy-2-butanone 4-phosphate synthase
 
Natronomonas pharaonis DSM 2160

Gene: NP0074A: 3,4-dihydroxy-2-butanone 4-phosphate synthase
3,4-dihydroxy-2-butanone 4-phosphate synthase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD