Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog RbkR - Thermococcales

Properties
Regulator type: Transcription factor
Regulator family: [Other]
Regulation mode:
Biological process: Riboflavin biosynthesis
Effector: Flavin mononucleotide
Phylum: Euryarchaeota
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 13 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Pyrococcus abyssi GE5 1 1
Pyrococcus furiosus DSM 3638 5 2
Pyrococcus horikoshii OT3 1 1
Thermococcus gammatolerans EJ3 4 1
Thermococcus kodakaraensis KOD1 5 3
Thermococcus onnurineus NA1 5 2
Thermococcus sibiricus MM 739 1 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
ribBA
 
Pyrococcus abyssi GE5
*
Pyrococcus furiosus DSM 3638

Site:
position = -23
score = 4.56364
sequence = TAGTTCTATACTTGAGACAT

Site:
position = -56
score = 4.92515
sequence = CTGTCTTATTTTTGGAACAC

Gene: PF0064: 3,4-dihydroxy-2-butanone 4-phosphate synthase / GTP cyclohydrolase II (EC 3.5.4.25)
 
Pyrococcus horikoshii OT3
 
Thermococcus gammatolerans EJ3

Gene: TGAM_1256: 3,4-dihydroxy-2-butanone 4-phosphate synthase / GTP cyclohydrolase II (EC 3.5.4.25)
*
Thermococcus kodakaraensis KOD1

Site:
position = -62
score = 5.81594
sequence = TGATTCCATTTTTGGAACAA

Site:
position = -40
score = 4.56159
sequence = TTTTTAAAAATTTAGAACAT

Gene: TK0428: 3,4-dihydroxy-2-butanone 4-phosphate synthase / GTP cyclohydrolase II (EC 3.5.4.25)
 
Thermococcus onnurineus NA1

Gene: TON_0608: 3,4-dihydroxy-2-butanone 4-phosphate synthase / GTP cyclohydrolase II (EC 3.5.4.25)
 
Thermococcus sibiricus MM 739
3,4-dihydroxy-2-butanone 4-phosphate synthase / GTP cyclohydrolase II (EC 3.5.4.25)
ribH
 
Pyrococcus abyssi GE5
 
Pyrococcus furiosus DSM 3638

Gene: PF0063: 6,7-dimethyl-8-ribityllumazine synthase (EC 2.5.1.9)
 
Pyrococcus horikoshii OT3
 
Thermococcus gammatolerans EJ3

Gene: TGAM_1257: 6,7-dimethyl-8-ribityllumazine synthase (EC 2.5.1.9)
 
Thermococcus kodakaraensis KOD1

Gene: TK0429: 6,7-dimethyl-8-ribityllumazine synthase (EC 2.5.1.9)
 
Thermococcus onnurineus NA1

Gene: TON_0607: 6,7-dimethyl-8-ribityllumazine synthase (EC 2.5.1.9)
 
Thermococcus sibiricus MM 739
6,7-dimethyl-8-ribityllumazine synthase (EC 2.5.1.9)
ribD
 
Pyrococcus abyssi GE5
 
Pyrococcus furiosus DSM 3638

Gene: PF0062: Diaminohydroxyphosphoribosylaminopyrimidine deaminase (EC 3.5.4.26) / 5-amino-6-(5-phosphoribosylamino)uracil reductase (EC 1.1.1.193)
 
Pyrococcus horikoshii OT3
*
Thermococcus gammatolerans EJ3

Site:
position = 92
score = 6.00711
sequence = ATGTTCCAAAAACGGAACAA

Gene: TGAM_1254: Diaminohydroxyphosphoribosylaminopyrimidine deaminase (EC 3.5.4.26) / 5-amino-6-(5-phosphoribosylamino)uracil reductase (EC 1.1.1.193)
*
Thermococcus kodakaraensis KOD1

Site:
position = -52
score = 5.98256
sequence = TTGTTCCAACCTTGGAACAA

Gene: TK0424: Diaminohydroxyphosphoribosylaminopyrimidine deaminase (EC 3.5.4.26) / 5-amino-6-(5-phosphoribosylamino)uracil reductase (EC 1.1.1.193)
*
Thermococcus onnurineus NA1

Site:
position = -53
score = 6.34218
sequence = TTATTCCAATTTTGGAACAA

Gene: TON_0610: Diaminohydroxyphosphoribosylaminopyrimidine deaminase (EC 3.5.4.26) / 5-amino-6-(5-phosphoribosylamino)uracil reductase (EC 1.1.1.193)
 
Thermococcus sibiricus MM 739
Diaminohydroxyphosphoribosylaminopyrimidine deaminase (EC 3.5.4.26) / 5-amino-6-(5-phosphoribosylamino)uracil reductase (EC 1.1.1.193)
ribE
 
Pyrococcus abyssi GE5
 
Pyrococcus furiosus DSM 3638

Gene: PF0061: Riboflavin synthase alpha chain (EC 2.5.1.9)
 
Pyrococcus horikoshii OT3
 
Thermococcus gammatolerans EJ3

Gene: TGAM_1255: Riboflavin synthase alpha chain (EC 2.5.1.9)
 
Thermococcus kodakaraensis KOD1

Gene: TK0425: Riboflavin synthase alpha chain (EC 2.5.1.9)
 
Thermococcus onnurineus NA1

Gene: TON_0609: Riboflavin synthase alpha chain (EC 2.5.1.9)
 
Thermococcus sibiricus MM 739
Riboflavin synthase alpha chain (EC 2.5.1.9)
 
CRON 2.
ribU
*
Pyrococcus abyssi GE5

Site:
position = -62
score = 5.50143
sequence = TCGTTCAAAATTTGGAACAT

Gene: PAB2198: Substrate-specific component RibU of riboflavin ECF transporter
*
Pyrococcus furiosus DSM 3638

Site:
position = 133
score = 6.06914
sequence = TTGTTCTGAAAATGGAACAA

Gene: PF0163: Substrate-specific component RibU of riboflavin ECF transporter
*
Pyrococcus horikoshii OT3

Site:
position = -62
score = 6.16034
sequence = TTGTTCCAATTATAGAACAT

Gene: PH0251: Substrate-specific component RibU of riboflavin ECF transporter
 
Thermococcus gammatolerans EJ3
*
Thermococcus kodakaraensis KOD1

Site:
position = -62
score = 6.1196
sequence = TTGTTCTATGTATGGAACAA

Gene: TK2194: Substrate-specific component RibU of riboflavin ECF transporter
*
Thermococcus onnurineus NA1

Site:
position = -62
score = 5.60532
sequence = GTGTTTCATATTGGGAACAA

Gene: TON_1440: Substrate-specific component RibU of riboflavin ECF transporter
*
Thermococcus sibiricus MM 739

Site:
position = -61
score = 6.03545
sequence = ATATTCCAATTATGGAACAA

Gene: TSIB_0195: Substrate-specific component RibU of riboflavin ECF transporter
Substrate-specific component RibU of riboflavin ECF transporter
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD