Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CblR - Thermoproteales

Properties
Regulator type: Transcription factor
Regulator family:
Regulation mode:
Biological process: Cobalamin biosynthesis
Effector:
Phylum: Crenarchaeota
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 9 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Pyrobaculum arsenaticum DSM 13514
Pyrobaculum aerophilum str. IM2 12 3
Pyrobaculum islandicum DSM 4184 3 1
Pyrobaculum calidifontis JCM 11548 12 3
Thermoproteus neutrophilus V24Sta 7 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
btuF
 
Pyrobaculum arsenaticum DSM 13514

Gene: Pars_2136: Vitamin B12 ABC transporter, B12-binding component BtuF
*
Pyrobaculum aerophilum str. IM2

Site:
position = -21
score = 4.54506
sequence = TAATGGAGGATTCTCCAGCT

Gene: PAE0367: Vitamin B12 ABC transporter, B12-binding component BtuF
 
Pyrobaculum islandicum DSM 4184

Gene: Pisl_1954: Vitamin B12 ABC transporter, B12-binding component BtuF
*
Pyrobaculum calidifontis JCM 11548

Site:
position = -21
score = 5.92645
sequence = TATGGGATATTTCTCCCACA

Gene: Pcal_1519: Vitamin B12 ABC transporter, B12-binding component BtuF
 
Thermoproteus neutrophilus V24Sta

Gene: Tneu_1093: Vitamin B12 ABC transporter, B12-binding component BtuF
Vitamin B12 ABC transporter, B12-binding component BtuF
btuC
 
Pyrobaculum arsenaticum DSM 13514

Gene: Pars_2137: Vitamin B12 ABC transporter, permease component BtuC
 
Pyrobaculum aerophilum str. IM2

Gene: PAE0366: Vitamin B12 ABC transporter, permease component BtuC
 
Pyrobaculum islandicum DSM 4184

Gene: Pisl_1955: Vitamin B12 ABC transporter, permease component BtuC
 
Pyrobaculum calidifontis JCM 11548

Gene: Pcal_1518: Vitamin B12 ABC transporter, permease component BtuC
 
Thermoproteus neutrophilus V24Sta

Gene: Tneu_1092: Vitamin B12 ABC transporter, permease component BtuC
Vitamin B12 ABC transporter, permease component BtuC
btuD
 
Pyrobaculum arsenaticum DSM 13514

Gene: Pars_2138: Vitamin B12 ABC transporter, ATPase component BtuD
 
Pyrobaculum aerophilum str. IM2

Gene: PAE0360: Vitamin B12 ABC transporter, ATPase component BtuD
 
Pyrobaculum islandicum DSM 4184

Gene: Pisl_1956: Vitamin B12 ABC transporter, ATPase component BtuD
 
Pyrobaculum calidifontis JCM 11548

Gene: Pcal_1517: Vitamin B12 ABC transporter, ATPase component BtuD
 
Thermoproteus neutrophilus V24Sta

Gene: Tneu_1091: Vitamin B12 ABC transporter, ATPase component BtuD
Vitamin B12 ABC transporter, ATPase component BtuD
 
CRON 2.
nrdD
 
Pyrobaculum arsenaticum DSM 13514
 
Pyrobaculum aerophilum str. IM2
*
Pyrobaculum islandicum DSM 4184

Site:
position = -23
score = 6.00215
sequence = TATGGGAAATTTGTCCCTTA

Gene: Pisl_0226: Ribonucleotide reductase of class III (anaerobic), large subunit (EC 1.17.4.2)
 
Pyrobaculum calidifontis JCM 11548
*
Thermoproteus neutrophilus V24Sta

Site:
position = -23
score = 5.82613
sequence = TATGGGAAATTTGTCCCCTA

Gene: Tneu_0378: Ribonucleotide reductase of class III (anaerobic), large subunit (EC 1.17.4.2)
Ribonucleotide reductase of class III (anaerobic), large subunit (EC 1.17.4.2)
nrdG
 
Pyrobaculum arsenaticum DSM 13514
 
Pyrobaculum aerophilum str. IM2
 
Pyrobaculum islandicum DSM 4184

Gene: Pisl_0225: Ribonucleotide reductase of class III (anaerobic), activating protein (EC 1.97.1.4)
 
Pyrobaculum calidifontis JCM 11548
 
Thermoproteus neutrophilus V24Sta

Gene: Tneu_0379: Ribonucleotide reductase of class III (anaerobic), activating protein (EC 1.97.1.4)
Ribonucleotide reductase of class III (anaerobic), activating protein (EC 1.97.1.4)
Pisl_0224
 
Pyrobaculum arsenaticum DSM 13514
 
Pyrobaculum aerophilum str. IM2
 
Pyrobaculum islandicum DSM 4184

Gene: Pisl_0224: hypothetical protein
 
Pyrobaculum calidifontis JCM 11548
 
Thermoproteus neutrophilus V24Sta

Gene: Tneu_0380: hypothetical protein
hypothetical protein
 
CRON 3.
PAE0341
 
Pyrobaculum arsenaticum DSM 13514
*
Pyrobaculum aerophilum str. IM2

Site:
position = -23
score = 4.98975
sequence = TATAGGATTTTTTTCCACTA

Gene: PAE0341: hypothetical protein
 
Pyrobaculum islandicum DSM 4184
 
Pyrobaculum calidifontis JCM 11548
 
Thermoproteus neutrophilus V24Sta
hypothetical protein
cbtA
 
Pyrobaculum arsenaticum DSM 13514
 
Pyrobaculum aerophilum str. IM2

Gene: PAE0342: Predicted cobalt transporter CbtA
 
Pyrobaculum islandicum DSM 4184
*
Pyrobaculum calidifontis JCM 11548

Site:
position = -239
score = 5.10359
sequence = TATAGGAGAAATATCCCAAC

Gene: Pcal_1527: Predicted cobalt transporter CbtA
*
Thermoproteus neutrophilus V24Sta

Site:
position = -232
score = 5.06005
sequence = TTAGGGATTTTTCTCCATCA

Gene: Tneu_0292: Predicted cobalt transporter CbtA
Predicted cobalt transporter CbtA
cbiC
 
Pyrobaculum arsenaticum DSM 13514
 
Pyrobaculum aerophilum str. IM2

Gene: PAE0343: Cobalt-precorrin-8x methylmutase (EC 5.4.1.2)
 
Pyrobaculum islandicum DSM 4184
 
Pyrobaculum calidifontis JCM 11548

Gene: Pcal_1526: Cobalt-precorrin-8x methylmutase (EC 5.4.1.2)
 
Thermoproteus neutrophilus V24Sta

Gene: Tneu_0296: Cobalt-precorrin-8x methylmutase (EC 5.4.1.2)
Cobalt-precorrin-8x methylmutase (EC 5.4.1.2)
cbiH
 
Pyrobaculum arsenaticum DSM 13514

Gene: Pars_1221: Cobalt-precorrin-3b C17-methyltransferase
 
Pyrobaculum aerophilum str. IM2

Gene: PAE0344: Cobalt-precorrin-3b C17-methyltransferase
 
Pyrobaculum islandicum DSM 4184
 
Pyrobaculum calidifontis JCM 11548

Gene: Pcal_1525: Cobalt-precorrin-3b C17-methyltransferase
 
Thermoproteus neutrophilus V24Sta

Gene: Tneu_0297: Cobalt-precorrin-3b C17-methyltransferase
Cobalt-precorrin-3b C17-methyltransferase
cbiD
 
Pyrobaculum arsenaticum DSM 13514
 
Pyrobaculum aerophilum str. IM2

Gene: PAE0346: Cobalt-precorrin-6 synthase, anaerobic
 
Pyrobaculum islandicum DSM 4184
 
Pyrobaculum calidifontis JCM 11548

Gene: Pcal_1524: Cobalt-precorrin-6 synthase, anaerobic
 
Thermoproteus neutrophilus V24Sta

Gene: Tneu_0298: Cobalt-precorrin-6 synthase, anaerobic
Cobalt-precorrin-6 synthase, anaerobic
cbiT
 
Pyrobaculum arsenaticum DSM 13514
 
Pyrobaculum aerophilum str. IM2

Gene: PAE0347: Cobalt-precorrin-6y C15-methyltransferase [decarboxylating] (EC 2.1.1.-)
 
Pyrobaculum islandicum DSM 4184
 
Pyrobaculum calidifontis JCM 11548

Gene: Pcal_1523: Cobalt-precorrin-6y C15-methyltransferase [decarboxylating] (EC 2.1.1.-)
 
Thermoproteus neutrophilus V24Sta

Gene: Tneu_0299: Cobalt-precorrin-6y C15-methyltransferase [decarboxylating] (EC 2.1.1.-)
Cobalt-precorrin-6y C15-methyltransferase [decarboxylating] (EC 2.1.1.-)
cbiL
 
Pyrobaculum arsenaticum DSM 13514
 
Pyrobaculum aerophilum str. IM2

Gene: PAE0348: Cobalt-precorrin-2 C20-methyltransferase (EC 2.1.1.130)
 
Pyrobaculum islandicum DSM 4184
 
Pyrobaculum calidifontis JCM 11548

Gene: Pcal_1522: Cobalt-precorrin-2 C20-methyltransferase (EC 2.1.1.130)
 
Thermoproteus neutrophilus V24Sta

Gene: Tneu_0300: Cobalt-precorrin-2 C20-methyltransferase (EC 2.1.1.130)
Cobalt-precorrin-2 C20-methyltransferase (EC 2.1.1.130)
cbiF
 
Pyrobaculum arsenaticum DSM 13514
 
Pyrobaculum aerophilum str. IM2

Gene: PAE0349: Cobalt-precorrin-4 C11-methyltransferase (EC 2.1.1.133)
 
Pyrobaculum islandicum DSM 4184
 
Pyrobaculum calidifontis JCM 11548

Gene: Pcal_1521: Cobalt-precorrin-4 C11-methyltransferase (EC 2.1.1.133)
 
Thermoproteus neutrophilus V24Sta

Gene: Tneu_0301: Cobalt-precorrin-4 C11-methyltransferase (EC 2.1.1.133)
Cobalt-precorrin-4 C11-methyltransferase (EC 2.1.1.133)
cbiG
 
Pyrobaculum arsenaticum DSM 13514
 
Pyrobaculum aerophilum str. IM2

Gene: PAE0339: Cobalamin biosynthesis protein CbiG
 
Pyrobaculum islandicum DSM 4184
 
Pyrobaculum calidifontis JCM 11548

Gene: Pcal_1529: Cobalamin biosynthesis protein CbiG
 
Thermoproteus neutrophilus V24Sta

Gene: Tneu_0291: Cobalamin biosynthesis protein CbiG
Cobalamin biosynthesis protein CbiG
cobD
 
Pyrobaculum arsenaticum DSM 13514
 
Pyrobaculum aerophilum str. IM2

Gene: PAE0377: L-threonine 3-O-phosphate decarboxylase (EC 4.1.1.81)
 
Pyrobaculum islandicum DSM 4184

Gene: Pisl_1369: L-threonine 3-O-phosphate decarboxylase (EC 4.1.1.81)
 
Pyrobaculum calidifontis JCM 11548

Gene: Pcal_1536: L-threonine 3-O-phosphate decarboxylase (EC 4.1.1.81)
 
Thermoproteus neutrophilus V24Sta

Gene: Tneu_0290: L-threonine 3-O-phosphate decarboxylase (EC 4.1.1.81)
L-threonine 3-O-phosphate decarboxylase (EC 4.1.1.81)
cobS
 
Pyrobaculum arsenaticum DSM 13514
 
Pyrobaculum aerophilum str. IM2

Gene: PAE0379: Cobalamin-5-phosphate synthase CobS
 
Pyrobaculum islandicum DSM 4184

Gene: Pisl_1370: Cobalamin-5-phosphate synthase CobS
 
Pyrobaculum calidifontis JCM 11548

Gene: Pcal_1535: Cobalamin-5-phosphate synthase CobS
 
Thermoproteus neutrophilus V24Sta

Gene: Tneu_0289: Cobalamin-5-phosphate synthase CobS
Cobalamin-5-phosphate synthase CobS
cbiE
 
Pyrobaculum arsenaticum DSM 13514
*
Pyrobaculum aerophilum str. IM2

Site:
position = -89
score = 4.98975
sequence = TAGTGGAAAAAAATCCTATA

Gene: PAE0340: Cobalt-precorrin-6y C5-methyltransferase (EC 2.1.1.-)
 
Pyrobaculum islandicum DSM 4184
*
Pyrobaculum calidifontis JCM 11548

Site:
position = -65
score = 5.10359
sequence = GTTGGGATATTTCTCCTATA

Gene: Pcal_1528: Cobalt-precorrin-6y C5-methyltransferase (EC 2.1.1.-)
 
Thermoproteus neutrophilus V24Sta
Cobalt-precorrin-6y C5-methyltransferase (EC 2.1.1.-)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD