Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HutC - Ralstonia

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Histidine utilization
Effector: cis-Urocanic acid
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 22 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Cupriavidus taiwanensis 13 3
Ralstonia eutropha H16 12 3
Ralstonia eutropha JMP134 15 4
Ralstonia metallidurans CH34 14 3
Ralstonia pickettii 12J 7 3
Ralstonia solanacearum GMI1000 5 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
hutH
*
Cupriavidus taiwanensis

Site:
position = -26
score = 5.62207
sequence = TAAGCTGTATAGACAGGAAC

Gene: RALTA_A2492: Histidine ammonia-lyase (EC 4.3.1.3)
*
Ralstonia eutropha H16

Site:
position = -26
score = 5.62207
sequence = TAAGCTGTATAGACAGGAAC

Gene: H16_A3018: Histidine ammonia-lyase (EC 4.3.1.3)
*2
Ralstonia eutropha JMP134

Gene: Reut_B5637: Histidine ammonia-lyase (EC 4.3.1.3)

Site:
position = -40
score = 5.62207
sequence = TAAGCTGTATAGACAGGAAC

Gene: Reut_A2716: Histidine ammonia-lyase (EC 4.3.1.3)
*2
Ralstonia metallidurans CH34

Gene: Rmet_5047: Histidine ammonia-lyase (EC 4.3.1.3)

Site:
position = -59
score = 5.08975
sequence = TAACCTGTATAGACAGGCCC

Gene: Rmet_2855: Histidine ammonia-lyase (EC 4.3.1.3)
 
Ralstonia pickettii 12J

Gene: Rpic_2880: Histidine ammonia-lyase (EC 4.3.1.3)
 
Ralstonia solanacearum GMI1000

Gene: RSc2646: Histidine ammonia-lyase (EC 4.3.1.3)
Histidine ammonia-lyase (EC 4.3.1.3)
hutU
*2
Cupriavidus taiwanensis

Gene: RALTA_A2491: Urocanate hydratase (EC 4.2.1.49)

Site:
position = -83
score = 5.55162
sequence = GCACTTGTATATACAGGAAT

Gene: RALTA_A0654: Urocanate hydratase (EC 4.2.1.49)
*2
Ralstonia eutropha H16

Site:
position = -83
score = 5.40951
sequence = ATGCCTGTATATACAGGACT

Gene: H16_A0695: Urocanate hydratase (EC 4.2.1.49)

Gene: H16_A3017: Urocanate hydratase (EC 4.2.1.49)
*3
Ralstonia eutropha JMP134

Gene: Reut_A2715: Urocanate hydratase (EC 4.2.1.49)

Site:
position = -94
score = 5.59118
sequence = ATGCTTGTATATACAACACT

Gene: Reut_A0896: Urocanate hydratase (EC 4.2.1.49)

Site:
position = -94
score = 5.59118
sequence = ATGCTTGTATATACAACACT

Gene: Reut_B5636: Urocanate hydratase (EC 4.2.1.49)
*2
Ralstonia metallidurans CH34

Site:
position = -88
score = 4.73014
sequence = CAACTTGTCTATACAATACT

Gene: Rmet_5048: Urocanate hydratase (EC 4.2.1.49)

Gene: Rmet_2854: Urocanate hydratase (EC 4.2.1.49)
*
Ralstonia pickettii 12J

Site:
position = -60
score = 6.10331
sequence = TAAGTTGTATATACAACATA

Gene: Rpic_2881: Urocanate hydratase (EC 4.2.1.49)
*
Ralstonia solanacearum GMI1000

Site:
position = -53
score = 5.78373
sequence = TTATTTGTATATACAACATA

Gene: RSc2647: Urocanate hydratase (EC 4.2.1.49)
Urocanate hydratase (EC 4.2.1.49)
hutD
 
Cupriavidus taiwanensis

Gene: RALTA_A2490: Conserved hypothetical protein related to histidine degradation
 
Ralstonia eutropha H16

Gene: H16_A3016: Conserved hypothetical protein related to histidine degradation
 
Ralstonia eutropha JMP134

Gene: Reut_A2714: Conserved hypothetical protein related to histidine degradation
 
Ralstonia metallidurans CH34

Gene: Rmet_2853: Conserved hypothetical protein related to histidine degradation
 
Ralstonia pickettii 12J
 
Ralstonia solanacearum GMI1000
Conserved hypothetical protein related to histidine degradation
hutI
 
Cupriavidus taiwanensis

Gene: RALTA_A2489: Imidazolonepropionase (EC 3.5.2.7)
 
Ralstonia eutropha H16

Gene: H16_A3015: Imidazolonepropionase (EC 3.5.2.7)
 
Ralstonia eutropha JMP134

Gene: Reut_A2713: Imidazolonepropionase (EC 3.5.2.7)
 
Ralstonia metallidurans CH34

Gene: Rmet_2852: Imidazolonepropionase (EC 3.5.2.7)
 
Ralstonia pickettii 12J

Gene: Rpic_2878: Imidazolonepropionase (EC 3.5.2.7)
 
Ralstonia solanacearum GMI1000

Gene: RSc2644: Imidazolonepropionase (EC 3.5.2.7)
Imidazolonepropionase (EC 3.5.2.7)
hutF
 
Cupriavidus taiwanensis

Gene: RALTA_A2488: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
 
Ralstonia eutropha H16

Gene: H16_A3014: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
 
Ralstonia eutropha JMP134

Gene: Reut_A2712: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
 
Ralstonia metallidurans CH34

Gene: Rmet_2851: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
 
Ralstonia pickettii 12J
 
Ralstonia solanacearum GMI1000
Formiminoglutamic iminohydrolase (EC 3.5.3.13)
hutG
 
Cupriavidus taiwanensis

Gene: RALTA_A2487: N-formylglutamate deformylase (EC 3.5.1.68)
 
Ralstonia eutropha H16

Gene: H16_A3013: N-formylglutamate deformylase (EC 3.5.1.68)
 
Ralstonia eutropha JMP134

Gene: Reut_A2711: N-formylglutamate deformylase (EC 3.5.1.68)
 
Ralstonia metallidurans CH34

Gene: Rmet_2850: N-formylglutamate deformylase (EC 3.5.1.68)
 
Ralstonia pickettii 12J
 
Ralstonia solanacearum GMI1000
N-formylglutamate deformylase (EC 3.5.1.68)
hutG2
 2
Cupriavidus taiwanensis

Gene: RALTA_A0652: Formiminoglutamase (EC 3.5.3.8)

Gene: RALTA_A0010: Formiminoglutamase (EC 3.5.3.8)
 
Ralstonia eutropha H16

Gene: H16_A0044: Formiminoglutamase (EC 3.5.3.8)
 
Ralstonia eutropha JMP134

Gene: Reut_A1591: Formiminoglutamase (EC 3.5.3.8)
 
Ralstonia metallidurans CH34

Gene: Rmet_5045: Formiminoglutamase (EC 3.5.3.8)
 2
Ralstonia pickettii 12J

Gene: Rpic_2879: Formiminoglutamase (EC 3.5.3.8)

Gene: Rpic_2795: Formiminoglutamase (EC 3.5.3.8)
 
Ralstonia solanacearum GMI1000

Gene: RS04571: Formiminoglutamase (EC 3.5.3.8)
Formiminoglutamase (EC 3.5.3.8)
hisT
 
Cupriavidus taiwanensis
 
Ralstonia eutropha H16
 
Ralstonia eutropha JMP134

Gene: Reut_B5638: Histidine transport protein (permease)
 
Ralstonia metallidurans CH34

Gene: Rmet_5046: Histidine transport protein (permease)
*
Ralstonia pickettii 12J

Site:
position = -126
score = 5.53292
sequence = CATGATGTATATACAACAAC

Gene: Rpic_0834: Histidine transport protein (permease)
 
Ralstonia solanacearum GMI1000
Histidine transport protein (permease)
COG2814 (AraJ)
 
Cupriavidus taiwanensis

Gene: RALTA_A0653: Putative histidine permease, major facilitator superfamily
 
Ralstonia eutropha H16

Gene: H16_A0694: Putative histidine permease, major facilitator superfamily
 3
Ralstonia eutropha JMP134

Gene: Reut_B5304: Putative histidine permease, major facilitator superfamily

Gene: Reut_C6354: Putative histidine permease, major facilitator superfamily

Gene: Reut_A0897: Putative histidine permease, major facilitator superfamily
 
Ralstonia metallidurans CH34
 
Ralstonia pickettii 12J

Gene: Rpic_0835: Putative histidine permease, major facilitator superfamily
 
Ralstonia solanacearum GMI1000
Putative histidine permease, major facilitator superfamily
 
CRON 2.
hisX
*
Cupriavidus taiwanensis

Site:
position = -247
score = 5.65278
sequence = GATCCTGTCTATACAGCAAC

Site:
position = -93
score = 5.43936
sequence = TGACTTGTATATACAGGCAT

Gene: RALTA_A2496: Putative histidine ABC transporter, substrate binding protein
*
Ralstonia eutropha H16

Site:
position = -93
score = 5.60807
sequence = TGACTTGTATATACAGGTAC

Site:
position = -249
score = 5.20991
sequence = TGTCCTGTCTATACAGCAGC

Gene: H16_A3022: Putative histidine ABC transporter, substrate binding protein
*
Ralstonia eutropha JMP134

Site:
position = -94
score = 5.67179
sequence = TGACTTGTATATACAGGATT

Site:
position = -249
score = 5.37126
sequence = ACTCCTGTCTATACAGCAAC

Gene: Reut_A2720: Putative histidine ABC transporter, substrate binding protein
*
Ralstonia metallidurans CH34

Site:
position = -114
score = 5.21767
sequence = TGACTTGTATATACAGCGTT

Site:
position = -271
score = 5.83693
sequence = CTTGTTGTATATACAGCAAT

Gene: Rmet_2859: Putative histidine ABC transporter, substrate binding protein
 
Ralstonia pickettii 12J
 
Ralstonia solanacearum GMI1000
Putative histidine ABC transporter, substrate binding protein
hisY
 
Cupriavidus taiwanensis

Gene: RALTA_A2495: Putative histidine ABC transporter, permease protein
 
Ralstonia eutropha H16

Gene: H16_A3021: Putative histidine ABC transporter, permease protein
 
Ralstonia eutropha JMP134

Gene: Reut_A2719: Putative histidine ABC transporter, permease protein
 
Ralstonia metallidurans CH34

Gene: Rmet_2858: Putative histidine ABC transporter, permease protein
 
Ralstonia pickettii 12J
 
Ralstonia solanacearum GMI1000
Putative histidine ABC transporter, permease protein
hisZ
 
Cupriavidus taiwanensis

Gene: RALTA_A2494: Putative histidine ABC transporter, ATPase protein
 
Ralstonia eutropha H16

Gene: H16_A3020: Putative histidine ABC transporter, ATPase protein
 
Ralstonia eutropha JMP134

Gene: Reut_A2718: Putative histidine ABC transporter, ATPase protein
 
Ralstonia metallidurans CH34

Gene: Rmet_2857: Putative histidine ABC transporter, ATPase protein
 
Ralstonia pickettii 12J
 
Ralstonia solanacearum GMI1000
Putative histidine ABC transporter, ATPase protein
hutC
 
Cupriavidus taiwanensis

Gene: RALTA_A2493: Histidine utilization repressor, GntR family
 
Ralstonia eutropha H16

Gene: H16_A3019: Histidine utilization repressor, GntR family
 
Ralstonia eutropha JMP134

Gene: Reut_A2717: Histidine utilization repressor, GntR family
 
Ralstonia metallidurans CH34

Gene: Rmet_2856: Histidine utilization repressor, GntR family
 
Ralstonia pickettii 12J
 
Ralstonia solanacearum GMI1000
Histidine utilization repressor, GntR family
 
CRON 3.
hutC
 
Cupriavidus taiwanensis
 
Ralstonia eutropha H16
 
Ralstonia eutropha JMP134
 
Ralstonia metallidurans CH34
*
Ralstonia pickettii 12J

Site:
position = -114
score = 6.10331
sequence = TATGTTGTATATACAACTTA

Gene: Rpic_2882: Histidine utilization repressor, GntR family
*
Ralstonia solanacearum GMI1000

Site:
position = -99
score = 5.78373
sequence = TATGTTGTATATACAAATAA

Gene: RSc2648: Histidine utilization repressor, GntR family
Histidine utilization repressor, GntR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD