Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HutC - Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Histidine utilization
Effector: cis-Urocanic acid
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 25 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Pseudoalteromonas atlantica T6c 5 2
Pseudoalteromonas haloplanktis TAC125 4 2
Pseudoalteromonas tunicata D2 2 2
Idiomarina loihiensis L2TR 12 3
Idiomarina baltica OS145 4 2
Alteromonas macleodii 'Deep ecotype' 5 2
Alteromonadales bacterium TW-7 4 2
Colwellia psychrerythraea 34H 17 5
Glaciecola sp. HTCC2999
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
hutI
*
Pseudoalteromonas atlantica T6c

Site:
position = -50
score = 5.67686
sequence = ATACAAGTATGTACAAGTAA

Site:
position = -60
score = 6.51905
sequence = AAACTTGTATATACAAGTAT

Gene: Patl_1019: Imidazolonepropionase (EC 3.5.2.7)
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -70
score = 5.32919
sequence = TACCTTGTATATACAAGATG

Gene: PSHAa2737: Imidazolonepropionase (EC 3.5.2.7)
*
Pseudoalteromonas tunicata D2

Site:
position = -68
score = 5.06762
sequence = AGTATTGTATATACAAGCCG

Gene: PTD2_07454: Imidazolonepropionase (EC 3.5.2.7)
*
Idiomarina loihiensis L2TR

Site:
position = -62
score = 6.12134
sequence = ATAATTGTATATACAAGCAG

Gene: IL2453: Imidazolonepropionase (EC 3.5.2.7)
*
Idiomarina baltica OS145

Site:
position = -77
score = 4.34636
sequence = TCATTTGTCTATACAACCTG

Gene: OS145_09068: Imidazolonepropionase (EC 3.5.2.7)
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -101
score = 6.74667
sequence = ATACTTGTATATACAAGTAT

Site:
position = -91
score = 4.87724
sequence = ATACAAGTATGCACAAGTAC

Gene: MADE_03129: Imidazolonepropionase (EC 3.5.2.7)
*
Alteromonadales bacterium TW-7

Site:
position = -69
score = 4.7575
sequence = CCTCTTGTATATACAAGATG

Gene: ATW7_17853: Imidazolonepropionase (EC 3.5.2.7)
*
Colwellia psychrerythraea 34H

Site:
position = -153
score = 5.49192
sequence = AGAGTTGTATATACAAGTTG

Gene: CPS_0911: Imidazolonepropionase (EC 3.5.2.7)
 
Glaciecola sp. HTCC2999
Imidazolonepropionase (EC 3.5.2.7)
hutG2
 
Pseudoalteromonas atlantica T6c

Gene: Patl_1018: Formiminoglutamase (EC 3.5.3.8)
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina loihiensis L2TR
 
Idiomarina baltica OS145
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_03130: Formiminoglutamase (EC 3.5.3.8)
 
Alteromonadales bacterium TW-7
 
Colwellia psychrerythraea 34H
 
Glaciecola sp. HTCC2999
Formiminoglutamase (EC 3.5.3.8)
 
CRON 2.
hisG
 
Pseudoalteromonas atlantica T6c

Gene: Patl_2880: ATP phosphoribosyltransferase (EC 2.4.2.17)
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAb0494: ATP phosphoribosyltransferase (EC 2.4.2.17)
 
Pseudoalteromonas tunicata D2

Gene: PTD2_02256: ATP phosphoribosyltransferase (EC 2.4.2.17)
*
Idiomarina loihiensis L2TR

Site:
position = -301
score = 4.37103
sequence = TTATTTGACTATACAACCAC

Gene: IL1834: ATP phosphoribosyltransferase (EC 2.4.2.17)
 
Idiomarina baltica OS145

Gene: OS145_10250: ATP phosphoribosyltransferase (EC 2.4.2.17)
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_01118: ATP phosphoribosyltransferase (EC 2.4.2.17)
 
Alteromonadales bacterium TW-7

Gene: ATW7_00290: ATP phosphoribosyltransferase (EC 2.4.2.17)
*
Colwellia psychrerythraea 34H

Site:
position = -54
score = 5.00432
sequence = TAAATTGTATATACATGACG

Gene: CPS_3889: ATP phosphoribosyltransferase (EC 2.4.2.17)
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100009696: ATP phosphoribosyltransferase (EC 2.4.2.17)
ATP phosphoribosyltransferase (EC 2.4.2.17)
hisD
 
Pseudoalteromonas atlantica T6c

Gene: Patl_2881: Histidinol dehydrogenase (EC 1.1.1.23)
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAb0493: Histidinol dehydrogenase (EC 1.1.1.23)
 
Pseudoalteromonas tunicata D2

Gene: PTD2_02261: Histidinol dehydrogenase (EC 1.1.1.23)
 
Idiomarina loihiensis L2TR

Gene: IL1835: Histidinol dehydrogenase (EC 1.1.1.23)
 
Idiomarina baltica OS145

Gene: OS145_10245: Histidinol dehydrogenase (EC 1.1.1.23)
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_01117: Histidinol dehydrogenase (EC 1.1.1.23)
 
Alteromonadales bacterium TW-7

Gene: ATW7_00285: Histidinol dehydrogenase (EC 1.1.1.23)
 
Colwellia psychrerythraea 34H

Gene: CPS_3890: Histidinol dehydrogenase (EC 1.1.1.23)
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100009701: Histidinol dehydrogenase (EC 1.1.1.23)
Histidinol dehydrogenase (EC 1.1.1.23)
hisC
 
Pseudoalteromonas atlantica T6c

Gene: Patl_2882: Histidinol-phosphate aminotransferase (EC 2.6.1.9)
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAb0492: Histidinol-phosphate aminotransferase (EC 2.6.1.9)
 
Pseudoalteromonas tunicata D2

Gene: PTD2_02266: Histidinol-phosphate aminotransferase (EC 2.6.1.9)
 
Idiomarina loihiensis L2TR

Gene: IL1836: Histidinol-phosphate aminotransferase (EC 2.6.1.9)
 
Idiomarina baltica OS145

Gene: OS145_10240: Histidinol-phosphate aminotransferase (EC 2.6.1.9)
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_01116: Histidinol-phosphate aminotransferase (EC 2.6.1.9)
 
Alteromonadales bacterium TW-7

Gene: ATW7_00280: Histidinol-phosphate aminotransferase (EC 2.6.1.9)
 
Colwellia psychrerythraea 34H

Gene: CPS_3891: Histidinol-phosphate aminotransferase (EC 2.6.1.9)
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100009706: Histidinol-phosphate aminotransferase (EC 2.6.1.9)
Histidinol-phosphate aminotransferase (EC 2.6.1.9)
hisB
 
Pseudoalteromonas atlantica T6c

Gene: Patl_2883: Histidinol-phosphatase (EC 3.1.3.15) / Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAb0491: Histidinol-phosphatase (EC 3.1.3.15) / Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
 
Pseudoalteromonas tunicata D2

Gene: PTD2_02271: Histidinol-phosphatase (EC 3.1.3.15) / Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
 
Idiomarina loihiensis L2TR

Gene: IL1837: Histidinol-phosphatase (EC 3.1.3.15) / Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
 
Idiomarina baltica OS145

Gene: OS145_10235: Histidinol-phosphatase (EC 3.1.3.15) / Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_01115: Histidinol-phosphatase (EC 3.1.3.15) / Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
 
Alteromonadales bacterium TW-7

Gene: ATW7_00275: Histidinol-phosphatase (EC 3.1.3.15) / Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
 
Colwellia psychrerythraea 34H

Gene: CPS_3892: Histidinol-phosphatase (EC 3.1.3.15) / Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100009711: Histidinol-phosphatase (EC 3.1.3.15) / Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
Histidinol-phosphatase (EC 3.1.3.15) / Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
hisH
 
Pseudoalteromonas atlantica T6c

Gene: Patl_2884: Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAb0490: Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
 
Pseudoalteromonas tunicata D2

Gene: PTD2_02276: Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
 
Idiomarina loihiensis L2TR

Gene: IL1838: Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
 
Idiomarina baltica OS145

Gene: OS145_10230: Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_01114: Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
 
Alteromonadales bacterium TW-7

Gene: ATW7_00270: Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
 
Colwellia psychrerythraea 34H

Gene: CPS_3893: Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100009716: Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
hisA
 
Pseudoalteromonas atlantica T6c

Gene: Patl_2885: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAb0489: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
 
Pseudoalteromonas tunicata D2

Gene: PTD2_02281: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
 
Idiomarina loihiensis L2TR

Gene: IL1839: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
 
Idiomarina baltica OS145

Gene: OS145_10225: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_01113: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
 
Alteromonadales bacterium TW-7

Gene: ATW7_00265: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
 
Colwellia psychrerythraea 34H

Gene: CPS_3894: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100009721: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
hisF
 
Pseudoalteromonas atlantica T6c

Gene: Patl_2887: Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAb0483: Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
 
Pseudoalteromonas tunicata D2

Gene: PTD2_02286: Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
 
Idiomarina loihiensis L2TR

Gene: IL1840: Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
 
Idiomarina baltica OS145

Gene: OS145_10220: Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_01112: Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
 
Alteromonadales bacterium TW-7

Gene: ATW7_00260: Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
 
Colwellia psychrerythraea 34H

Gene: CPS_3895: Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100009726: Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
hisI
 
Pseudoalteromonas atlantica T6c

Gene: Patl_2888: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAb0482: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
Pseudoalteromonas tunicata D2

Gene: PTD2_02291: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
Idiomarina loihiensis L2TR

Gene: IL1841: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
Idiomarina baltica OS145

Gene: OS145_10215: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 2
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_01111: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)

Gene: MADE_02956: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
Alteromonadales bacterium TW-7

Gene: ATW7_00255: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
Colwellia psychrerythraea 34H

Gene: CPS_3896: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100009731: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
CRON 3.
hutC
*
Pseudoalteromonas atlantica T6c

Site:
position = -66
score = 5.67686
sequence = TTACTTGTACATACTTGTAT

Site:
position = -56
score = 6.51905
sequence = ATACTTGTATATACAAGTTT

Gene: Patl_1020: Histidine utilization repressor, GntR family
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -70
score = 5.32919
sequence = CATCTTGTATATACAAGGTA

Gene: PSHAa2738: Histidine utilization repressor, GntR family
*
Pseudoalteromonas tunicata D2

Site:
position = -69
score = 5.06762
sequence = CGGCTTGTATATACAATACT

Gene: PTD2_07449: Histidine utilization repressor, GntR family
*
Idiomarina loihiensis L2TR

Site:
position = -81
score = 6.12134
sequence = CTGCTTGTATATACAATTAT

Gene: IL2452: Histidine utilization repressor, GntR family
*
Idiomarina baltica OS145

Site:
position = -70
score = 4.34636
sequence = CAGGTTGTATAGACAAATGA

Gene: OS145_09063: Histidine utilization repressor, GntR family
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -89
score = 4.87724
sequence = GTACTTGTGCATACTTGTAT

Site:
position = -79
score = 6.74667
sequence = ATACTTGTATATACAAGTAT

Gene: MADE_03128: Histidine utilization repressor, GntR family
*
Alteromonadales bacterium TW-7

Site:
position = -71
score = 4.7575
sequence = CATCTTGTATATACAAGAGG

Gene: ATW7_17848: Histidine utilization repressor, GntR family
*
Colwellia psychrerythraea 34H

Site:
position = -80
score = 5.49192
sequence = CAACTTGTATATACAACTCT

Gene: CPS_0910: Histidine utilization repressor, GntR family
 
Glaciecola sp. HTCC2999
Histidine utilization repressor, GntR family
hutU
 
Pseudoalteromonas atlantica T6c

Gene: Patl_1021: Urocanate hydratase (EC 4.2.1.49)
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAa2739: Urocanate hydratase (EC 4.2.1.49)
 
Pseudoalteromonas tunicata D2

Gene: PTD2_14952: Urocanate hydratase (EC 4.2.1.49)
 
Idiomarina loihiensis L2TR

Gene: IL2451: Urocanate hydratase (EC 4.2.1.49)
 
Idiomarina baltica OS145

Gene: OS145_09058: Urocanate hydratase (EC 4.2.1.49)
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_03127: Urocanate hydratase (EC 4.2.1.49)
*
Alteromonadales bacterium TW-7

Site:
position = -28
score = 4.29997
sequence = CACCTTGTATATACAACAGG

Gene: ATW7_17843: Urocanate hydratase (EC 4.2.1.49)
 
Colwellia psychrerythraea 34H

Gene: CPS_0909: Urocanate hydratase (EC 4.2.1.49)
 
Glaciecola sp. HTCC2999
Urocanate hydratase (EC 4.2.1.49)
hutH
 
Pseudoalteromonas atlantica T6c

Gene: Patl_1022: Histidine ammonia-lyase (EC 4.3.1.3)
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAa2740: Histidine ammonia-lyase (EC 4.3.1.3)
 
Pseudoalteromonas tunicata D2

Gene: PTD2_14947: Histidine ammonia-lyase (EC 4.3.1.3)
 
Idiomarina loihiensis L2TR

Gene: IL2450: Histidine ammonia-lyase (EC 4.3.1.3)
 
Idiomarina baltica OS145

Gene: OS145_09053: Histidine ammonia-lyase (EC 4.3.1.3)
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_03126: Histidine ammonia-lyase (EC 4.3.1.3)
 
Alteromonadales bacterium TW-7

Gene: ATW7_17838: Histidine ammonia-lyase (EC 4.3.1.3)
 
Colwellia psychrerythraea 34H

Gene: CPS_0908: Histidine ammonia-lyase (EC 4.3.1.3)
 
Glaciecola sp. HTCC2999
Histidine ammonia-lyase (EC 4.3.1.3)
 
CRON 4.
hutX
 
Pseudoalteromonas atlantica T6c
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina loihiensis L2TR
 
Idiomarina baltica OS145
 
Alteromonas macleodii 'Deep ecotype'
 
Alteromonadales bacterium TW-7
*
Colwellia psychrerythraea 34H

Site:
position = -192
score = 3.84154
sequence = GAGCGGGTATATACATAAAT

Gene: CPS_4933: Amino acid ABC transporter, periplasmic amino acid-binding protein
 
Glaciecola sp. HTCC2999
Amino acid ABC transporter, periplasmic amino acid-binding protein
hutW
 
Pseudoalteromonas atlantica T6c
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina loihiensis L2TR
 
Idiomarina baltica OS145
 
Alteromonas macleodii 'Deep ecotype'
 
Alteromonadales bacterium TW-7
 
Colwellia psychrerythraea 34H

Gene: CPS_4934: L-proline glycine betaine ABC transport system permease protein ProW (TC 3.A.1.12.1)
 
Glaciecola sp. HTCC2999
L-proline glycine betaine ABC transport system permease protein ProW (TC 3.A.1.12.1)
hutV
 
Pseudoalteromonas atlantica T6c
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina loihiensis L2TR
 
Idiomarina baltica OS145
 
Alteromonas macleodii 'Deep ecotype'
 
Alteromonadales bacterium TW-7
 
Colwellia psychrerythraea 34H

Gene: CPS_4935: L-proline glycine betaine ABC transport system permease protein ProV (TC 3.A.1.12.1)
 
Glaciecola sp. HTCC2999
L-proline glycine betaine ABC transport system permease protein ProV (TC 3.A.1.12.1)
 
CRON 5.
hutG
 
Pseudoalteromonas atlantica T6c
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina loihiensis L2TR
 
Idiomarina baltica OS145
 
Alteromonas macleodii 'Deep ecotype'
 
Alteromonadales bacterium TW-7
*
Colwellia psychrerythraea 34H

Site:
position = -46
score = 5.1136
sequence = CAAGTTGTATATACAATTTG

Gene: CPS_4353: N-formylglutamate deformylase (EC 3.5.1.68)
 
Glaciecola sp. HTCC2999
N-formylglutamate deformylase (EC 3.5.1.68)
hutF
 
Pseudoalteromonas atlantica T6c
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina loihiensis L2TR
 
Idiomarina baltica OS145
 
Alteromonas macleodii 'Deep ecotype'
 
Alteromonadales bacterium TW-7
 
Colwellia psychrerythraea 34H

Gene: CPS_4352: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
 
Glaciecola sp. HTCC2999
Formiminoglutamic iminohydrolase (EC 3.5.3.13)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD