Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog MurR - Staphylococcaceae

Properties
Regulator type: Transcription factor
Regulator family: RpiR
Regulation mode: repressor
Biological process: N-acetylmuramate utilization
Effector: N-acetylmuramate-6-phosphate
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Staphylococcus aureus subsp. aureus N315 4 1
Staphylococcus capitis SK14 4 1
Staphylococcus epidermidis ATCC 12228 4 1
Staphylococcus carnosus subsp. carnosus TM300 4 1
Staphylococcus haemolyticus JCSC1435 4 1
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 4 1
Macrococcus caseolyticus JCSC5402
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
SA0184
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -133
score = 5.41776
sequence = ATATGTAAGATTATTACAATG

Gene: SA0184: Outer surface protein of unknown function, N-acetylmuramate-related
*
Staphylococcus capitis SK14

Site:
position = -65
score = 5.32307
sequence = AATTGTAAACGTTTAATAATA

Gene: STACA0001_1175: Outer surface protein of unknown function, N-acetylmuramate-related
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -66
score = 5.32115
sequence = AATTGTAAACTTGTTGCAATA

Gene: SE1888: Outer surface protein of unknown function, N-acetylmuramate-related
*
Staphylococcus carnosus subsp. carnosus TM300

Site:
position = -114
score = 5.56253
sequence = TATTGTAATAAAATTTCAATT

Gene: Sca_2140: Outer surface protein of unknown function, N-acetylmuramate-related
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -91
score = 5.64808
sequence = AATTATAAAAATTATATAATA

Gene: SH0743: Outer surface protein of unknown function, N-acetylmuramate-related
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -64
score = 5.5899
sequence = AATTGTAATACTTTTTCATAT

Site:
position = -105
score = 5.30345
sequence = ATTTGTAATAAAATTTCATTT

Gene: SSP0596: Outer surface protein of unknown function, N-acetylmuramate-related
 
Macrococcus caseolyticus JCSC5402
Outer surface protein of unknown function, N-acetylmuramate-related
murQ
 
Staphylococcus aureus subsp. aureus N315

Gene: SA0185: N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-)
 
Staphylococcus capitis SK14

Gene: STACA0001_1174: N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-)
 
Staphylococcus epidermidis ATCC 12228

Gene: SE1889: N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-)
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_2139: N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-)
 
Staphylococcus haemolyticus JCSC1435

Gene: SH0742: N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-)
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP0595: N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-)
 
Macrococcus caseolyticus JCSC5402
N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-)
murT
 
Staphylococcus aureus subsp. aureus N315

Gene: SA0186: predicted N-acetylmuramate PTS system, IIBC components
 
Staphylococcus capitis SK14

Gene: STACA0001_1173: predicted N-acetylmuramate PTS system, IIBC components
 
Staphylococcus epidermidis ATCC 12228

Gene: SE1890: predicted N-acetylmuramate PTS system, IIBC components
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_2138: predicted N-acetylmuramate PTS system, IIBC components
 
Staphylococcus haemolyticus JCSC1435

Gene: SH0741: predicted N-acetylmuramate PTS system, IIBC components
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP0594: predicted N-acetylmuramate PTS system, IIBC components
 
Macrococcus caseolyticus JCSC5402
predicted N-acetylmuramate PTS system, IIBC components
murR
 
Staphylococcus aureus subsp. aureus N315

Gene: SA0187: predicted N-acetylmuramate-6-phosphate-responsive transcriptional regulator, RpiR family
 
Staphylococcus capitis SK14

Gene: STACA0001_1172: predicted N-acetylmuramate-6-phosphate-responsive transcriptional regulator, RpiR family
 
Staphylococcus epidermidis ATCC 12228

Gene: SE1891: predicted N-acetylmuramate-6-phosphate-responsive transcriptional regulator, RpiR family
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_2137: predicted N-acetylmuramate-6-phosphate-responsive transcriptional regulator, RpiR family
 
Staphylococcus haemolyticus JCSC1435

Gene: SH0740: predicted N-acetylmuramate-6-phosphate-responsive transcriptional regulator, RpiR family
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP0593: predicted N-acetylmuramate-6-phosphate-responsive transcriptional regulator, RpiR family
 
Macrococcus caseolyticus JCSC5402
predicted N-acetylmuramate-6-phosphate-responsive transcriptional regulator, RpiR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD