Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PhrR - Vibrionales

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: repressor
Biological process: Light-dependent DNA repair
Effector: Heat shock; Adenosylcobalamin
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 16 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Vibrio angustum S14 12 1
Vibrio cholerae O1 biovar eltor str. N16961 12 2
Vibrio fischeri ES114
Vibrio harveyi ATCC BAA-1116 12 2
Vibrio parahaemolyticus RIMD 2210633 12 2
Vibrio salmonicida LFI1238
Vibrio shilonii AK1 12 2
Vibrio splendidus LGP32
Vibrio vulnificus CMCP6 12 2
Photobacterium profundum SS9
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
COG3272
*2
Vibrio angustum S14

Gene: VAS14_11854: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA

Site:
position = -87
score = 6.15881
sequence = TATACAATAAAAAAACTTGTACA

Gene: VAS14_11844: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -76
score = 6.74493
sequence = TGTACAAAAAAAATATTTGTACA

Site:
position = -28
score = 5.76117
sequence = TGTACAGAAATTTTCATTGTATA

Gene: VCA0055: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
 
Vibrio fischeri ES114

Gene: VF_A0752: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -81
score = 6.02085
sequence = TGTACATTTTATTTTCTTGTACA

Site:
position = -35
score = 6.10088
sequence = TATACAACAAAACATTTTGTATA

Gene: VIBHAR_05120: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -83
score = 6.4178
sequence = TGTACAACTAATTTTCTTGTACA

Site:
position = -37
score = 6.20311
sequence = TATACAACTAAACTTTTTGTATA

Gene: VPA1473: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0865: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
*
Vibrio shilonii AK1

Site:
position = -78
score = 5.61234
sequence = TGTACAAGATAGAATTTTGTATC

Gene: VSAK1_17997: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
 
Vibrio splendidus LGP32

Gene: VS_II1450: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
*
Vibrio vulnificus CMCP6

Site:
position = -35
score = 6.67285
sequence = TGTACAAGTAATTTTTTTGTACA

Site:
position = -81
score = 6.74493
sequence = TGTACAAAAAAAATATTTGTACA

Gene: VV21541: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
 
Photobacterium profundum SS9
COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
VAS14_11849
 
Vibrio angustum S14

Gene: VAS14_11849: hypothetical protein
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_04941: hypothetical protein
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA1560: hypothetical protein
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0223: hypothetical protein
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32

Gene: VS_1177: hypothetical protein
 
Vibrio vulnificus CMCP6
 
Photobacterium profundum SS9

Gene: PBPRB0196: hypothetical protein
hypothetical protein
metY
 
Vibrio angustum S14

Gene: VAS14_11859: O-acetylhomoserine sulfhydrylase (EC 2.5.1.49) / O-succinylhomoserine sulfhydrylase (EC 2.5.1.48)
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP0629: O-acetylhomoserine sulfhydrylase (EC 2.5.1.49) / O-succinylhomoserine sulfhydrylase (EC 2.5.1.48)
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1

Gene: VSAK1_14570: O-acetylhomoserine sulfhydrylase (EC 2.5.1.49) / O-succinylhomoserine sulfhydrylase (EC 2.5.1.48)
 
Vibrio splendidus LGP32

Gene: VS_0395: O-acetylhomoserine sulfhydrylase (EC 2.5.1.49) / O-succinylhomoserine sulfhydrylase (EC 2.5.1.48)
 
Vibrio vulnificus CMCP6
 
Photobacterium profundum SS9

Gene: PBPRB1415: O-acetylhomoserine sulfhydrylase (EC 2.5.1.49) / O-succinylhomoserine sulfhydrylase (EC 2.5.1.48)
O-acetylhomoserine sulfhydrylase (EC 2.5.1.49) / O-succinylhomoserine sulfhydrylase (EC 2.5.1.48)
phrR
 
Vibrio angustum S14

Gene: VAS14_11864: Transcriptional regulator, MerR family, associated with photolyase
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VCA0056: Transcriptional regulator, MerR family, associated with photolyase
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_05121: Transcriptional regulator, MerR family, associated with photolyase
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA1472: Transcriptional regulator, MerR family, associated with photolyase
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1

Gene: VSAK1_17992: Transcriptional regulator, MerR family, associated with photolyase
 
Vibrio splendidus LGP32
 
Vibrio vulnificus CMCP6

Gene: VV21542: Transcriptional regulator, MerR family, associated with photolyase
 
Photobacterium profundum SS9
Transcriptional regulator, MerR family, associated with photolyase
phr
 
Vibrio angustum S14

Gene: VAS14_11869: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VCA0057: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
 
Vibrio fischeri ES114

Gene: VF_A0753: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_05122: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA1471: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0866: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
 
Vibrio shilonii AK1

Gene: VSAK1_17987: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
 
Vibrio splendidus LGP32

Gene: VS_II1451: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
 
Vibrio vulnificus CMCP6

Gene: VV21543: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
 
Photobacterium profundum SS9
Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
PF07366
 
Vibrio angustum S14

Gene: VAS14_11874: Protein of unknown function DUF1486
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -32
score = 5.57279
sequence = TATACGAATCTTAAATTTGTATA

Gene: VC1118: Protein of unknown function DUF1486
 
Vibrio fischeri ES114

Gene: VF_A0764: Protein of unknown function DUF1486
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -51
score = 6.47882
sequence = TGTACATATAATATTTTTGTACA

Gene: VIBHAR_01814: Protein of unknown function DUF1486
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -51
score = 6.33457
sequence = TGTACATGTAATATTTTTGTACA

Site:
position = -96
score = 6.41387
sequence = TATACAAGTTTTTTTTTTGTACA

Gene: VP1119: Protein of unknown function DUF1486
 
Vibrio salmonicida LFI1238
*
Vibrio shilonii AK1

Site:
position = -95
score = 4.60909
sequence = TATACAAAAAGTTGTACTTTCCA

Gene: VSAK1_00115: Protein of unknown function DUF1486
 
Vibrio splendidus LGP32

Gene: VS_II1452: Protein of unknown function DUF1486
*
Vibrio vulnificus CMCP6

Site:
position = -93
score = 5.54089
sequence = TATACAAAAAAACAATCGGTATA

Gene: VV1_2936: Protein of unknown function DUF1486
 
Photobacterium profundum SS9
Protein of unknown function DUF1486
PF00106
 
Vibrio angustum S14

Gene: VAS14_11879: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC1119: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
 
Vibrio fischeri ES114

Gene: VF_A0763: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_01815: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP1120: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1

Gene: VSAK1_00120: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
 
Vibrio splendidus LGP32

Gene: VS_II1453: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
 
Vibrio vulnificus CMCP6

Gene: VV1_2935: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
 
Photobacterium profundum SS9
Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
PF01593
 
Vibrio angustum S14

Gene: VAS14_11884: Flavin containing amine oxidoreductase
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC1120: Flavin containing amine oxidoreductase
 
Vibrio fischeri ES114

Gene: VF_A0762: Flavin containing amine oxidoreductase
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_01816: Flavin containing amine oxidoreductase
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP1121: Flavin containing amine oxidoreductase
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1

Gene: VSAK1_00125: Flavin containing amine oxidoreductase
 
Vibrio splendidus LGP32

Gene: VS_II1454: Flavin containing amine oxidoreductase
 
Vibrio vulnificus CMCP6

Gene: VV1_2934: Flavin containing amine oxidoreductase
 
Photobacterium profundum SS9
Flavin containing amine oxidoreductase
PF07103
 
Vibrio angustum S14

Gene: VAS14_11889: Protein of unknown function DUF1365
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC1121: Protein of unknown function DUF1365
 
Vibrio fischeri ES114

Gene: VF_A0761: Protein of unknown function DUF1365
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_01817: Protein of unknown function DUF1365
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP1122: Protein of unknown function DUF1365
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0873: Protein of unknown function DUF1365
 
Vibrio shilonii AK1

Gene: VSAK1_00130: Protein of unknown function DUF1365
 
Vibrio splendidus LGP32

Gene: VS_II1455: Protein of unknown function DUF1365
 
Vibrio vulnificus CMCP6

Gene: VV1_2933: Protein of unknown function DUF1365
 
Photobacterium profundum SS9
Protein of unknown function DUF1365
PF02353
 
Vibrio angustum S14

Gene: VAS14_11894: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC1122: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
 
Vibrio fischeri ES114

Gene: VF_A0760: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_01818: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP1123: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1

Gene: VSAK1_00135: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
 
Vibrio splendidus LGP32

Gene: VS_II1456: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
 
Vibrio vulnificus CMCP6

Gene: VV1_2932: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
 
Photobacterium profundum SS9
S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
PF11086
 
Vibrio angustum S14

Gene: VAS14_11899: Protein of unknown function DUF2878
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC1123: Protein of unknown function DUF2878
 
Vibrio fischeri ES114

Gene: VF_A0759: Protein of unknown function DUF2878
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_01819: Protein of unknown function DUF2878
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP1124: Protein of unknown function DUF2878
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0871: Protein of unknown function DUF2878
 
Vibrio shilonii AK1

Gene: VSAK1_00140: Protein of unknown function DUF2878
 
Vibrio splendidus LGP32

Gene: VS_II1457: Protein of unknown function DUF2878
 
Vibrio vulnificus CMCP6

Gene: VV1_2931: Protein of unknown function DUF2878
 
Photobacterium profundum SS9
Protein of unknown function DUF2878
FIG026291
 
Vibrio angustum S14

Gene: VAS14_11909: FIG026291: Hypothetical periplasmic protein
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC1124: FIG026291: Hypothetical periplasmic protein
 
Vibrio fischeri ES114

Gene: VF_A0758: FIG026291: Hypothetical periplasmic protein
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_01820: FIG026291: Hypothetical periplasmic protein
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP1125: FIG026291: Hypothetical periplasmic protein
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0870: FIG026291: Hypothetical periplasmic protein
 
Vibrio shilonii AK1

Gene: VSAK1_00145: FIG026291: Hypothetical periplasmic protein
 
Vibrio splendidus LGP32

Gene: VS_II1458: FIG026291: Hypothetical periplasmic protein
 
Vibrio vulnificus CMCP6

Gene: VV1_2930: FIG026291: Hypothetical periplasmic protein
 
Photobacterium profundum SS9
FIG026291: Hypothetical periplasmic protein
FIG002577
 
Vibrio angustum S14

Gene: VAS14_11914: FIG002577: Putative lipoprotein precursor
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC1125: FIG002577: Putative lipoprotein precursor
 
Vibrio fischeri ES114

Gene: VF_A0757: FIG002577: Putative lipoprotein precursor
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_01821: FIG002577: Putative lipoprotein precursor
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP1126: FIG002577: Putative lipoprotein precursor
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0869: FIG002577: Putative lipoprotein precursor
 
Vibrio shilonii AK1

Gene: VSAK1_00150: FIG002577: Putative lipoprotein precursor
 
Vibrio splendidus LGP32

Gene: VS_II1459: FIG002577: Putative lipoprotein precursor
 
Vibrio vulnificus CMCP6

Gene: VV1_2929: FIG002577: Putative lipoprotein precursor
 
Photobacterium profundum SS9

Gene: PBPRB0893: FIG002577: Putative lipoprotein precursor
FIG002577: Putative lipoprotein precursor
ykuD
 
Vibrio angustum S14

Gene: VAS14_11704: L,D-transpeptidase catalytic domain
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VCA0058: L,D-transpeptidase catalytic domain
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_05123: L,D-transpeptidase catalytic domain
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA1470: L,D-transpeptidase catalytic domain
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1

Gene: VSAK1_17982: L,D-transpeptidase catalytic domain
 
Vibrio splendidus LGP32

Gene: VS_II0198: L,D-transpeptidase catalytic domain
 
Vibrio vulnificus CMCP6

Gene: VV21544: L,D-transpeptidase catalytic domain
 
Photobacterium profundum SS9

Gene: PBPRB0743: L,D-transpeptidase catalytic domain
L,D-transpeptidase catalytic domain
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD