Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PhrR - Pseudomonadaceae

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: repressor
Biological process: Light-dependent DNA repair
Effector: Blue light; Adenosylcobalamin
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 43 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Azotobacter vinelandii AvOP 7 2
Pseudomonas aeruginosa PAO1 4 2
Pseudomonas entomophila L48 17 5
Pseudomonas fluorescens Pf-5 17 5
Pseudomonas mendocina ymp 19 5
Pseudomonas putida KT2440 15 5
Pseudomonas stutzeri A1501 13 3
Pseudomonas syringae pv. tomato str. DC3000 19 5
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
COG1090
 
Azotobacter vinelandii AvOP

Gene: Avin_41380: Predicted nucleoside-diphosphate sugar epimerase
 
Pseudomonas aeruginosa PAO1

Gene: PA4656: Predicted nucleoside-diphosphate sugar epimerase
*
Pseudomonas entomophila L48

Site:
position = -137
score = 5.48454
sequence = TGTACAATGCACAATGTTTGTATA

Gene: PSEEN0885: Predicted nucleoside-diphosphate sugar epimerase
*
Pseudomonas fluorescens Pf-5

Site:
position = -147
score = 5.57655
sequence = TGTACAATATTGTTTTTTGGTATA

Gene: PFL_5142: Predicted nucleoside-diphosphate sugar epimerase
*
Pseudomonas mendocina ymp

Site:
position = -131
score = 6.13282
sequence = TATACAAGAATGTTTTCATGTACA

Gene: Pmen_1076: Predicted nucleoside-diphosphate sugar epimerase
*
Pseudomonas putida KT2440

Site:
position = -136
score = 5.30897
sequence = TGTACAATGCCAAAATTATGTATA

Gene: PP0743: Predicted nucleoside-diphosphate sugar epimerase
*
Pseudomonas stutzeri A1501

Site:
position = -85
score = 5.21713
sequence = TGTACATTCGAATAACCATGTATA

Gene: PST_1967: Predicted nucleoside-diphosphate sugar epimerase
*
Pseudomonas syringae pv. tomato str. DC3000

Site:
position = -240
score = 5.50449
sequence = TGTACAATCTTCTTGTTTGGTATA

Gene: PSPTO1127: Predicted nucleoside-diphosphate sugar epimerase
Predicted nucleoside-diphosphate sugar epimerase
hemH
 
Azotobacter vinelandii AvOP

Gene: Avin_41370: Ferrochelatase, protoheme ferro-lyase (EC 4.99.1.1)
 
Pseudomonas aeruginosa PAO1

Gene: PA4655: Ferrochelatase, protoheme ferro-lyase (EC 4.99.1.1)
 
Pseudomonas entomophila L48

Gene: PSEEN0886: Ferrochelatase, protoheme ferro-lyase (EC 4.99.1.1)
 
Pseudomonas fluorescens Pf-5

Gene: PFL_5141: Ferrochelatase, protoheme ferro-lyase (EC 4.99.1.1)
 
Pseudomonas mendocina ymp

Gene: Pmen_1077: Ferrochelatase, protoheme ferro-lyase (EC 4.99.1.1)
 
Pseudomonas putida KT2440

Gene: PP0744: Ferrochelatase, protoheme ferro-lyase (EC 4.99.1.1)
 
Pseudomonas stutzeri A1501

Gene: PST_1968: Ferrochelatase, protoheme ferro-lyase (EC 4.99.1.1)
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO1128: Ferrochelatase, protoheme ferro-lyase (EC 4.99.1.1)
Ferrochelatase, protoheme ferro-lyase (EC 4.99.1.1)
 
CRON 2.
folM
*
Azotobacter vinelandii AvOP

Site:
position = -78
score = 4.40369
sequence = TGTACAAAGCGGGACACTGCTATA

Gene: Avin_10270: FolM Alternative dihydrofolate reductase 1
 
Pseudomonas aeruginosa PAO1

Gene: PA3437: FolM Alternative dihydrofolate reductase 1
 
Pseudomonas entomophila L48

Gene: PSEEN4623: FolM Alternative dihydrofolate reductase 1
 
Pseudomonas fluorescens Pf-5

Gene: PFL_0950: FolM Alternative dihydrofolate reductase 1
*
Pseudomonas mendocina ymp

Site:
position = -251
score = 5.58199
sequence = TGTACAAAACACATGGATCGTACA

Site:
position = -118
score = 4.56068
sequence = TGTACAACCCGCAGCTCTGGTATA

Gene: Pmen_3288: FolM Alternative dihydrofolate reductase 1
 
Pseudomonas putida KT2440

Gene: PP4632: FolM Alternative dihydrofolate reductase 1
 
Pseudomonas stutzeri A1501

Gene: PST_1136: FolM Alternative dihydrofolate reductase 1
*
Pseudomonas syringae pv. tomato str. DC3000

Site:
position = -101
score = 6.0939
sequence = TGTACAAAAAAATTCTCTGGTATA

Gene: PSPTO1183: FolM Alternative dihydrofolate reductase 1
FolM Alternative dihydrofolate reductase 1
folE
 
Azotobacter vinelandii AvOP
 
Pseudomonas aeruginosa PAO1

Gene: PA3438: GTP cyclohydrolase I (EC 3.5.4.16) type 1
 
Pseudomonas entomophila L48
*2
Pseudomonas fluorescens Pf-5

Gene: PFL_0949: GTP cyclohydrolase I (EC 3.5.4.16) type 1

Site:
position = -229
score = 4.25293
sequence = TGTACAGATAAAAAGTATTGAATC

Site:
position = -190
score = 4.81819
sequence = TGTACAAGTATTTGGGCTTATAAG

Site:
position = -145
score = 4.3812
sequence = TGTACAAAAAATTAAATTGTCGTA

Gene: PFL_2258: GTP cyclohydrolase I (EC 3.5.4.16) type 1
 
Pseudomonas mendocina ymp

Gene: Pmen_3289: GTP cyclohydrolase I (EC 3.5.4.16) type 1
 
Pseudomonas putida KT2440

Gene: PP2512: GTP cyclohydrolase I (EC 3.5.4.16) type 1
 
Pseudomonas stutzeri A1501
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO1182: GTP cyclohydrolase I (EC 3.5.4.16) type 1
GTP cyclohydrolase I (EC 3.5.4.16) type 1
folB
 
Azotobacter vinelandii AvOP

Gene: Avin_10260: Dihydroneopterin triphosphate epimerase
 
Pseudomonas aeruginosa PAO1

Gene: PA3439: Dihydroneopterin triphosphate epimerase
 
Pseudomonas entomophila L48
 
Pseudomonas fluorescens Pf-5

Gene: PFL_0948: Dihydroneopterin triphosphate epimerase
 
Pseudomonas mendocina ymp

Gene: Pmen_3290: Dihydroneopterin triphosphate epimerase
 
Pseudomonas putida KT2440
 
Pseudomonas stutzeri A1501

Gene: PST_1135: Dihydroneopterin triphosphate epimerase
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO1181: Dihydroneopterin triphosphate epimerase
Dihydroneopterin triphosphate epimerase
PF06844
 
Azotobacter vinelandii AvOP

Gene: Avin_10250: protein of unknown function DUF1244
 
Pseudomonas aeruginosa PAO1

Gene: PA3440: protein of unknown function DUF1244
 
Pseudomonas entomophila L48

Gene: PSEEN4624: protein of unknown function DUF1244
 
Pseudomonas fluorescens Pf-5

Gene: PFL_0947: protein of unknown function DUF1244
 
Pseudomonas mendocina ymp

Gene: Pmen_3291: protein of unknown function DUF1244
 
Pseudomonas putida KT2440

Gene: PP4633: protein of unknown function DUF1244
 
Pseudomonas stutzeri A1501

Gene: PST_1134: protein of unknown function DUF1244
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO1180: protein of unknown function DUF1244
protein of unknown function DUF1244
PF08888
 
Azotobacter vinelandii AvOP

Gene: Avin_10240: HopJ type III effector protein
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48

Gene: PSEEN4625: HopJ type III effector protein
 
Pseudomonas fluorescens Pf-5

Gene: PFL_0946: HopJ type III effector protein
 
Pseudomonas mendocina ymp

Gene: Pmen_3292: HopJ type III effector protein
 
Pseudomonas putida KT2440
 
Pseudomonas stutzeri A1501

Gene: PST_1133: HopJ type III effector protein
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO1179: HopJ type III effector protein
HopJ type III effector protein
PSEEN2737
 
Azotobacter vinelandii AvOP
 
Pseudomonas aeruginosa PAO1
*
Pseudomonas entomophila L48

Site:
position = -49
score = 6.31376
sequence = TGTACAAGAACCTAGTCTTGTACA

Gene: PSEEN2737: FIG026291: Hypothetical periplasmic protein
 
Pseudomonas fluorescens Pf-5

Gene: PFL_2259: FIG026291: Hypothetical periplasmic protein
 
Pseudomonas mendocina ymp

Gene: Pmen_3102: FIG026291: Hypothetical periplasmic protein
 
Pseudomonas putida KT2440

Gene: PP2729: FIG026291: Hypothetical periplasmic protein
 
Pseudomonas stutzeri A1501
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO2514: FIG026291: Hypothetical periplasmic protein
FIG026291: Hypothetical periplasmic protein
PF12915
 
Azotobacter vinelandii AvOP
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48

Gene: PSEEN2738: Protein of unknown function (DUF3833)
 
Pseudomonas fluorescens Pf-5

Gene: PFL_2260: Protein of unknown function (DUF3833)
 
Pseudomonas mendocina ymp

Gene: Pmen_3103: Protein of unknown function (DUF3833)
 
Pseudomonas putida KT2440

Gene: PP2730: Protein of unknown function (DUF3833)
 
Pseudomonas stutzeri A1501
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO2515: Protein of unknown function (DUF3833)
Protein of unknown function (DUF3833)
phrB
 
Azotobacter vinelandii AvOP
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48

Gene: PSEEN2739: DNA photolyase PhrB
 
Pseudomonas fluorescens Pf-5
 
Pseudomonas mendocina ymp
 
Pseudomonas putida KT2440

Gene: PP2732: DNA photolyase PhrB
 
Pseudomonas stutzeri A1501

Gene: PST_0952: DNA photolyase PhrB
*
Pseudomonas syringae pv. tomato str. DC3000

Site:
position = -47
score = 6.02411
sequence = TGTACAAAAATTTACATTGGTACA

Gene: PSPTO3689: DNA photolyase PhrB
DNA photolyase PhrB
PSEEN2740
 
Azotobacter vinelandii AvOP
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48

Gene: PSEEN2740: hypothetical protein
 
Pseudomonas fluorescens Pf-5
 
Pseudomonas mendocina ymp
 
Pseudomonas putida KT2440
 
Pseudomonas stutzeri A1501
 
Pseudomonas syringae pv. tomato str. DC3000
hypothetical protein
PP2511
 
Azotobacter vinelandii AvOP
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48
 
Pseudomonas fluorescens Pf-5
 
Pseudomonas mendocina ymp
*
Pseudomonas putida KT2440

Site:
position = -35
score = 4.731
sequence = TATACAAAAACTTGTACAAGCATG

Site:
position = -23
score = 5.12281
sequence = TGTACAAGCATGAGAGGTTGTACA

Gene: PP2511: Cell division inhibitor
 
Pseudomonas stutzeri A1501
 
Pseudomonas syringae pv. tomato str. DC3000
Cell division inhibitor
PF04134
 
Azotobacter vinelandii AvOP
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48
 
Pseudomonas fluorescens Pf-5
 
Pseudomonas mendocina ymp
 
Pseudomonas putida KT2440

Gene: PP2731: Putative thiol-disulphide oxidoreductase DCC
*
Pseudomonas stutzeri A1501

Site:
position = -57
score = 5.16263
sequence = TGTACAGGATTATTGTTTTGTTCA

Gene: PST_0951: Putative thiol-disulphide oxidoreductase DCC
 
Pseudomonas syringae pv. tomato str. DC3000
Putative thiol-disulphide oxidoreductase DCC
 
CRON 3.
mcp3
 
Azotobacter vinelandii AvOP
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48
*
Pseudomonas fluorescens Pf-5

Site:
position = -134
score = 6.05663
sequence = TGTACATGAAACTTTTTTTGTACA

Gene: PFL_2328: Methyl-accepting chemotaxis protein
 
Pseudomonas mendocina ymp
 
Pseudomonas putida KT2440
 
Pseudomonas stutzeri A1501
 
Pseudomonas syringae pv. tomato str. DC3000
Methyl-accepting chemotaxis protein
 
CRON 4.
mcp1
 
Azotobacter vinelandii AvOP
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48
 
Pseudomonas fluorescens Pf-5
*
Pseudomonas mendocina ymp

Site:
position = -94
score = 5.62994
sequence = TATACAAACAGGAATTCATGTACA

Gene: Pmen_1353: Methyl-accepting chemotaxis protein
 
Pseudomonas putida KT2440
 
Pseudomonas stutzeri A1501

Gene: PST_0356: Methyl-accepting chemotaxis protein
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO3685: Methyl-accepting chemotaxis protein
Methyl-accepting chemotaxis protein
 
CRON 5.
COG3380
 
Azotobacter vinelandii AvOP

Gene: Avin_41390: Predicted NAD/FAD-dependent oxidoreductase
*
Pseudomonas aeruginosa PAO1

Site:
position = -73
score = 5.94722
sequence = TGTACATTAAATCAAGCTTGTACA

Gene: PA4657: Predicted NAD/FAD-dependent oxidoreductase
*
Pseudomonas entomophila L48

Site:
position = -74
score = 5.88813
sequence = TATACAAACATTGTGCATTGTACA

Gene: PSEEN0884: Predicted NAD/FAD-dependent oxidoreductase
*
Pseudomonas fluorescens Pf-5

Site:
position = -71
score = 5.70407
sequence = TATACCAAAAAACAATATTGTACA

Gene: PFL_5143: Predicted NAD/FAD-dependent oxidoreductase
*
Pseudomonas mendocina ymp

Site:
position = -75
score = 5.87549
sequence = TGTACATGAAAACATTCTTGTATA

Gene: Pmen_1075: Predicted NAD/FAD-dependent oxidoreductase
*
Pseudomonas putida KT2440

Site:
position = -74
score = 5.81396
sequence = TATACATAATTTTGGCATTGTACA

Gene: PP0742: Predicted NAD/FAD-dependent oxidoreductase
 
Pseudomonas stutzeri A1501

Gene: PST_2515: Predicted NAD/FAD-dependent oxidoreductase
*
Pseudomonas syringae pv. tomato str. DC3000

Site:
position = -71
score = 5.43328
sequence = TATACCAAACAAGAAGATTGTACA

Gene: PSPTO1126: Predicted NAD/FAD-dependent oxidoreductase
Predicted NAD/FAD-dependent oxidoreductase
PF09493
 
Azotobacter vinelandii AvOP
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48
 
Pseudomonas fluorescens Pf-5

Gene: PFL_5144: Tryptophan-rich protein (DUF2389)
 
Pseudomonas mendocina ymp

Gene: Pmen_1074: Tryptophan-rich protein (DUF2389)
 
Pseudomonas putida KT2440
 
Pseudomonas stutzeri A1501
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO1125: Tryptophan-rich protein (DUF2389)
Tryptophan-rich protein (DUF2389)
 
CRON 6.
COG3272
*
Azotobacter vinelandii AvOP

Site:
position = -43
score = 4.97757
sequence = TATACAAATCATGAAAGCTGTACA

Site:
position = -94
score = 5.70596
sequence = TGTACAAACTGTTGATCATGTACA

Gene: Avin_41400: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
*
Pseudomonas aeruginosa PAO1

Site:
position = -106
score = 5.93001
sequence = TATACAAATACATTGACCTGTACA

Gene: PA4658: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
*
Pseudomonas entomophila L48

Site:
position = -43
score = 4.99184
sequence = TGTACAAACCAAGCCTTCTGTACA

Site:
position = -93
score = 5.55909
sequence = TATACAGAAAGTAACACTTGTATA

Gene: PSEEN0883: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
*
Pseudomonas fluorescens Pf-5

Site:
position = -97
score = 6.48806
sequence = TATACAAATAATTTGACTTGTACA

Gene: PFL_5145: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
*
Pseudomonas mendocina ymp

Site:
position = -42
score = 5.15889
sequence = TGTACATGCACCAACATATGTACA

Site:
position = -92
score = 6.38811
sequence = TGTACAAATCATTTGACTTGTACA

Gene: Pmen_1073: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
*
Pseudomonas putida KT2440

Site:
position = -95
score = 5.62387
sequence = TATACAAAAATACTAGTTTGCATA

Site:
position = -45
score = 4.99403
sequence = TGTACAAGTTTCGAGTCACGTACA

Gene: PP0741: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
*
Pseudomonas stutzeri A1501

Site:
position = -217
score = 5.29583
sequence = TATACATGGTTATTCGAATGTACA

Gene: PST_1966: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
*
Pseudomonas syringae pv. tomato str. DC3000

Site:
position = -101
score = 6.12539
sequence = TCTACAAAGAATTTGACTTGTACA

Site:
position = -51
score = 4.88574
sequence = TGTACAGCACAGTTAATCTGTACA

Gene: PSPTO1123: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
phrR
 
Azotobacter vinelandii AvOP

Gene: Avin_41410: Transcriptional regulator, MerR family, associated with photolyase
 
Pseudomonas aeruginosa PAO1

Gene: PA4659: Transcriptional regulator, MerR family, associated with photolyase
 
Pseudomonas entomophila L48

Gene: PSEEN0882: Transcriptional regulator, MerR family, associated with photolyase
 
Pseudomonas fluorescens Pf-5

Gene: PFL_5146: Transcriptional regulator, MerR family, associated with photolyase
 
Pseudomonas mendocina ymp

Gene: Pmen_1072: Transcriptional regulator, MerR family, associated with photolyase
 
Pseudomonas putida KT2440

Gene: PP0740: Transcriptional regulator, MerR family, associated with photolyase
 
Pseudomonas stutzeri A1501

Gene: PST_1965: Transcriptional regulator, MerR family, associated with photolyase
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO1122: Transcriptional regulator, MerR family, associated with photolyase
Transcriptional regulator, MerR family, associated with photolyase
phr
 
Azotobacter vinelandii AvOP

Gene: Avin_41430: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
 
Pseudomonas aeruginosa PAO1

Gene: PA4660: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
 
Pseudomonas entomophila L48

Gene: PSEEN0881: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
 
Pseudomonas fluorescens Pf-5

Gene: PFL_5147: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
 
Pseudomonas mendocina ymp

Gene: Pmen_1071: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
 
Pseudomonas putida KT2440

Gene: PP0739: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
 
Pseudomonas stutzeri A1501

Gene: PST_1964: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO1121: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
PF07366
 
Azotobacter vinelandii AvOP
 
Pseudomonas aeruginosa PAO1
*
Pseudomonas entomophila L48

Site:
position = -94
score = 6.06155
sequence = TGTACAAGACTATTGACCTGTACA

Site:
position = -43
score = 4.64607
sequence = TGTACAAAATCACCTCGCTGTACA

Gene: PSEEN2706: Protein of unknown function DUF1486
 
Pseudomonas fluorescens Pf-5

Gene: PFL_5148: Protein of unknown function DUF1486
 
Pseudomonas mendocina ymp

Gene: Pmen_1070: Protein of unknown function DUF1486
*
Pseudomonas putida KT2440

Site:
position = -94
score = 6.08141
sequence = TATACAAGACCGTTGACTTGTATA

Site:
position = -43
score = 5.68758
sequence = TGTACAACAATTCAATTTTGTACA

Gene: PP2738: Protein of unknown function DUF1486
 
Pseudomonas stutzeri A1501

Gene: PST_1963: Protein of unknown function DUF1486
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO1120: Protein of unknown function DUF1486
Protein of unknown function DUF1486
PF00106
 
Azotobacter vinelandii AvOP
 
Pseudomonas aeruginosa PAO1
 2
Pseudomonas entomophila L48

Gene: PSEEN2705: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)

Gene: PSEEN0880: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
 
Pseudomonas fluorescens Pf-5

Gene: PFL_5149: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
 
Pseudomonas mendocina ymp

Gene: Pmen_1069: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
 2
Pseudomonas putida KT2440

Gene: PP0738: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)

Gene: PP2737: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
 
Pseudomonas stutzeri A1501

Gene: PST_1962: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO1119: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
PF01593
 
Azotobacter vinelandii AvOP
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48

Gene: PSEEN2704: Flavin containing amine oxidoreductase
 
Pseudomonas fluorescens Pf-5

Gene: PFL_5150: Flavin containing amine oxidoreductase
 
Pseudomonas mendocina ymp

Gene: Pmen_1068: Flavin containing amine oxidoreductase
 
Pseudomonas putida KT2440

Gene: PP2736: Flavin containing amine oxidoreductase
 
Pseudomonas stutzeri A1501

Gene: PST_1961: Flavin containing amine oxidoreductase
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO1118: Flavin containing amine oxidoreductase
Flavin containing amine oxidoreductase
PF07103
 
Azotobacter vinelandii AvOP
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48

Gene: PSEEN2703: Protein of unknown function DUF1365
 
Pseudomonas fluorescens Pf-5

Gene: PFL_5151: Protein of unknown function DUF1365
 
Pseudomonas mendocina ymp

Gene: Pmen_1067: Protein of unknown function DUF1365
 
Pseudomonas putida KT2440

Gene: PP2735: Protein of unknown function DUF1365
 
Pseudomonas stutzeri A1501

Gene: PST_1960: Protein of unknown function DUF1365
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO1117: Protein of unknown function DUF1365
Protein of unknown function DUF1365
PF02353
 
Azotobacter vinelandii AvOP
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48

Gene: PSEEN2702: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
 
Pseudomonas fluorescens Pf-5

Gene: PFL_5152: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
 
Pseudomonas mendocina ymp

Gene: Pmen_1066: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
 
Pseudomonas putida KT2440

Gene: PP2734: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
 
Pseudomonas stutzeri A1501

Gene: PST_1959: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO1116: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
PF11086
 
Azotobacter vinelandii AvOP
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48

Gene: PSEEN2701: Protein of unknown function DUF2878
 
Pseudomonas fluorescens Pf-5

Gene: PFL_5153: Protein of unknown function DUF2878
 
Pseudomonas mendocina ymp

Gene: Pmen_1065: Protein of unknown function DUF2878
 
Pseudomonas putida KT2440

Gene: PP2733: Protein of unknown function DUF2878
 
Pseudomonas stutzeri A1501
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO1115: Protein of unknown function DUF2878
Protein of unknown function DUF2878
mcp4
 
Azotobacter vinelandii AvOP
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48
 
Pseudomonas fluorescens Pf-5
 
Pseudomonas mendocina ymp
 
Pseudomonas putida KT2440
 
Pseudomonas stutzeri A1501

Gene: PST_1958: methyl-accepting chemotaxis protein
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO0263: methyl-accepting chemotaxis protein
methyl-accepting chemotaxis protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD