Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog BglR - Bifidobacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization
Effector: Beta-glucoside
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bifidobacterium adolescentis ATCC 15703 5 2
Bifidobacterium angulatum DSM 20098 5 2
Bifidobacterium animalis subsp. lactis AD011
Bifidobacterium bifidum NCIMB 41171
Bifidobacterium breve DSM 20213 4 1
Bifidobacterium dentium Bd1 5 2
Bifidobacterium gallicum DSM 20093
Bifidobacterium longum NCC2705
Bifidobacterium longum subsp. infantis ATCC 15697
Gardnerella vaginalis 409-05
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
bglR
*
Bifidobacterium adolescentis ATCC 15703

Site:
position = -25
score = 5.83961
sequence = GCATCAAAGCGCTTAGACTG

Gene: BAD_1291: Transcriptional regulator of beta-glucosides utilization, LacI family
*
Bifidobacterium angulatum DSM 20098

Site:
position = -25
score = 5.84158
sequence = GTATCAAAGCGGTTAGACTG

Gene: BIFANG_00262: Transcriptional regulator of beta-glucosides utilization, LacI family
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213

Gene: BIFBRE_00246: Transcriptional regulator of beta-glucosides utilization, LacI family
*
Bifidobacterium dentium Bd1

Site:
position = -220
score = 5.32424
sequence = GTACCAAAGCGCTTAAATTG

Gene: BDP_0953: Transcriptional regulator of beta-glucosides utilization, LacI family
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Gardnerella vaginalis 409-05
Transcriptional regulator of beta-glucosides utilization, LacI family
 
CRON 2.
bglE
*
Bifidobacterium adolescentis ATCC 15703

Site:
position = -68
score = 5.90826
sequence = AAATCTAAGCGCTTAAATTG

Site:
position = -42
score = 6.73726
sequence = CAATCTAAGCGGTTAGATTG

Gene: BAD_1290: Beta-glucosides ABC transporter, substrate-binding protein
*
Bifidobacterium angulatum DSM 20098

Site:
position = -71
score = 5.0924
sequence = CAATCTATGCGCTTAAATAT

Site:
position = -45
score = 6.56763
sequence = CAGTCTAACCGCTTAGATTG

Gene: BIFANG_00261: Beta-glucosides ABC transporter, substrate-binding protein
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
*
Bifidobacterium breve DSM 20213

Site:
position = -52
score = 6.44678
sequence = CAATCTACGCGGTTAGATTG

Gene: BIFBRE_00248: Beta-glucosides ABC transporter, substrate-binding protein
*
Bifidobacterium dentium Bd1

Site:
position = -72
score = 5.62973
sequence = CAATCTAAGCGCTTAAATAT

Site:
position = -46
score = 6.56763
sequence = CAGTCTAACCGCTTAGATTG

Gene: BDP_0952: Beta-glucosides ABC transporter, substrate-binding protein
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Gardnerella vaginalis 409-05
Beta-glucosides ABC transporter, substrate-binding protein
bglF
 
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_1289: Beta-glucosides ABC transporter, permease component 1
 
Bifidobacterium angulatum DSM 20098

Gene: BIFANG_00260: Beta-glucosides ABC transporter, permease component 1
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213

Gene: BIFBRE_00249: Beta-glucosides ABC transporter, permease component 1
 
Bifidobacterium dentium Bd1

Gene: BDP_0951: Beta-glucosides ABC transporter, permease component 1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Gardnerella vaginalis 409-05
Beta-glucosides ABC transporter, permease component 1
bglG
 
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_1288: Beta-glucosides ABC transporter, permease component 2
 
Bifidobacterium angulatum DSM 20098

Gene: BIFANG_00259: Beta-glucosides ABC transporter, permease component 2
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213

Gene: BIFBRE_00250: Beta-glucosides ABC transporter, permease component 2
 
Bifidobacterium dentium Bd1

Gene: BDP_0950: Beta-glucosides ABC transporter, permease component 2
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Gardnerella vaginalis 409-05
Beta-glucosides ABC transporter, permease component 2
bglB
 
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_1287: Beta-glucosidase (EC 3.2.1.21)
 
Bifidobacterium angulatum DSM 20098

Gene: BIFANG_00258: Beta-glucosidase (EC 3.2.1.21)
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213

Gene: BIFBRE_00251: Beta-glucosidase (EC 3.2.1.21)
 
Bifidobacterium dentium Bd1

Gene: BDP_0949: Beta-glucosidase (EC 3.2.1.21)
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Gardnerella vaginalis 409-05
Beta-glucosidase (EC 3.2.1.21)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD