Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog MntR - Staphylococcaceae

Properties
Regulator type: Transcription factor
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 15 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Staphylococcus aureus subsp. aureus N315 4 2
Staphylococcus capitis SK14 4 2
Staphylococcus epidermidis ATCC 12228 4 2
Staphylococcus carnosus subsp. carnosus TM300 4 2
Staphylococcus haemolyticus JCSC1435 4 2
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 4 2
Macrococcus caseolyticus JCSC5402 4 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
mntH
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -67
score = 6.28253
sequence = AATTTAGGTTGACCTAAACA

Gene: SA0956: Mn2+/Fe2+ transporter, NRAMP family
*
Staphylococcus capitis SK14

Site:
position = -66
score = 6.08709
sequence = TTTTTAGGTTGACCTAACTT

Gene: STACA0001_2258: Mn2+/Fe2+ transporter, NRAMP family
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -51
score = 6.33114
sequence = TTTTTAGGTTGACCTAATAT

Site:
position = -29
score = 4.61618
sequence = TATTTAGGTTAATATATTCT

Gene: SE0803: Mn2+/Fe2+ transporter, NRAMP family
*
Staphylococcus carnosus subsp. carnosus TM300

Site:
position = -76
score = 6.08709
sequence = TTTTTAGGTTGACCTAACTT

Gene: Sca_0731: Mn2+/Fe2+ transporter, NRAMP family
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -65
score = 6.30942
sequence = TTATTAGGTTGACCTAAAAA

Gene: SH1847: Mn2+/Fe2+ transporter, NRAMP family
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -73
score = 6.30942
sequence = TTTTTAGGTTGACCTAATAA

Gene: SSP1685: Mn2+/Fe2+ transporter, NRAMP family
*
Macrococcus caseolyticus JCSC5402

Site:
position = -52
score = 5.68233
sequence = TTTTTAGGTTGCCCTAAAGA

Gene: MCCL_0368: Mn2+/Fe2+ transporter, NRAMP family
Mn2+/Fe2+ transporter, NRAMP family
 
CRON 2.
mntA
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -42
score = 6.12446
sequence = TAATTAGGTTAGCCTAAACT

Gene: SA0589: manganese ABC transport system ATPase component MntA
*
Staphylococcus capitis SK14

Site:
position = -42
score = 6.14618
sequence = AAATTAGGTTAGCCTAAACT

Gene: STACA0001_0395: manganese ABC transport system ATPase component MntA
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -42
score = 6.36587
sequence = AAATTAGGTTAACCTAAACT

Gene: SE0407: manganese ABC transport system ATPase component MntA
*
Staphylococcus carnosus subsp. carnosus TM300

Site:
position = -141
score = 6.22598
sequence = AAATTAGGTTAGCCTAAAAA

Gene: Sca_0275: manganese ABC transport system ATPase component MntA
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -40
score = 6.36587
sequence = AAATTAGGTTAACCTAAACT

Gene: SH0143: manganese ABC transport system ATPase component MntA
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -40
score = 6.22598
sequence = AAATTAGGTTAGCCTAAAAA

Gene: SSP2086: manganese ABC transport system ATPase component MntA
*
Macrococcus caseolyticus JCSC5402

Site:
position = -52
score = 5.8918
sequence = AGTTTAGGTTTGCCTAAAAT

Gene: MCCL_0095: manganese ABC transport system ATPase component MntA
manganese ABC transport system ATPase component MntA
mntB
 
Staphylococcus aureus subsp. aureus N315

Gene: SA0588: manganese ABC transport system membrane protein MntB
 
Staphylococcus capitis SK14

Gene: STACA0001_0396: manganese ABC transport system membrane protein MntB
 
Staphylococcus epidermidis ATCC 12228

Gene: SE0406: manganese ABC transport system membrane protein MntB
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_0274: manganese ABC transport system membrane protein MntB
 
Staphylococcus haemolyticus JCSC1435

Gene: SH0142: manganese ABC transport system membrane protein MntB
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP2087: manganese ABC transport system membrane protein MntB
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_0094: manganese ABC transport system membrane protein MntB
manganese ABC transport system membrane protein MntB
mntC
 
Staphylococcus aureus subsp. aureus N315

Gene: SA0587: manganese ABC transport system substrate-binding protein MntC
 
Staphylococcus capitis SK14

Gene: STACA0001_0397: manganese ABC transport system substrate-binding protein MntC
 
Staphylococcus epidermidis ATCC 12228

Gene: SE0405: manganese ABC transport system substrate-binding protein MntC
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_0273: manganese ABC transport system substrate-binding protein MntC
 
Staphylococcus haemolyticus JCSC1435

Gene: SH0141: manganese ABC transport system substrate-binding protein MntC
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP2088: manganese ABC transport system substrate-binding protein MntC
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_0093: manganese ABC transport system substrate-binding protein MntC
manganese ABC transport system substrate-binding protein MntC
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD