Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Zur - Bifidobacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 33 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bifidobacterium adolescentis ATCC 15703 4 3
Bifidobacterium angulatum DSM 20098 4 3
Bifidobacterium animalis subsp. lactis AD011 4 3
Bifidobacterium bifidum NCIMB 41171 5 4
Bifidobacterium breve DSM 20213 6 5
Bifidobacterium dentium Bd1 10 4
Bifidobacterium gallicum DSM 20093 3 2
Bifidobacterium longum NCC2705 2 2
Bifidobacterium longum subsp. infantis ATCC 15697 7 5
Gardnerella vaginalis 409-05 6 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
rpmB2
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
*
Bifidobacterium bifidum NCIMB 41171

Site:
position = 14
score = 5.57917
sequence = TTTTGATAATGATTATCATTA

Gene: BbifN4_010100006411: LSU ribosomal protein L28p
 
Bifidobacterium breve DSM 20213
*
Bifidobacterium dentium Bd1

Site:
position = -37
score = 6.14112
sequence = TATTGATAATGATTATCATTA

Gene: BDP_1883: LSU ribosomal protein L28p
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
*
Bifidobacterium longum subsp. infantis ATCC 15697

Site:
position = -37
score = 5.22909
sequence = ATTTGATAATGGTTATCATTA

Gene: Blon_1965: LSU ribosomal protein L28p
 
Gardnerella vaginalis 409-05
LSU ribosomal protein L28p
rpmG2
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1

Gene: BDP_1882: LSU ribosomal protein L33p
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_1966: LSU ribosomal protein L33p
 
Gardnerella vaginalis 409-05
LSU ribosomal protein L33p
rpsN2
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
*
Bifidobacterium breve DSM 20213

Site:
position = -19
score = 5.71551
sequence = TATTGAGAATTATTATCATTT

Gene: BIFBRE_00822: SSU ribosomal protein S14p
 
Bifidobacterium dentium Bd1

Gene: BDP_1881: SSU ribosomal protein S14p
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Gardnerella vaginalis 409-05
SSU ribosomal protein S14p
rpmJ2
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1

Gene: BDP_1879: LSU ribosomal protein L36p
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Gardnerella vaginalis 409-05
LSU ribosomal protein L36p
BDP_1880
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1

Gene: BDP_1880: hypothetical protein
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Gardnerella vaginalis 409-05
hypothetical protein
zinT
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
*
Bifidobacterium animalis subsp. lactis AD011

Site:
position = -60
score = 5.99025
sequence = TATTGAGAACGATTCCCAATA

Site:
position = -92
score = 6.23234
sequence = TATTGAGAATCGTTCTCATTT

Gene: BLA_0171: Candidate zinc-binding lipoprotein ZinT
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1

Gene: BDP_1878: Candidate zinc-binding lipoprotein ZinT
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Gardnerella vaginalis 409-05
Candidate zinc-binding lipoprotein ZinT
 
CRON 2.
zur
 
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_0517: Zinc uptake regulation protein ZUR
 
Bifidobacterium angulatum DSM 20098

Gene: BIFANG_00962: Zinc uptake regulation protein ZUR
 
Bifidobacterium animalis subsp. lactis AD011

Gene: BLA_1123: Zinc uptake regulation protein ZUR
 
Bifidobacterium bifidum NCIMB 41171

Gene: BbifN4_010100006451: Zinc uptake regulation protein ZUR
*2
Bifidobacterium breve DSM 20213

Site:
position = -45
score = 5.08654
sequence = TAACGATAATGAATATCATTT

Gene: BIFBRE_00816: Zinc uptake regulation protein ZUR

Gene: BIFBRE_00810: Zinc uptake regulation protein ZUR
 
Bifidobacterium dentium Bd1

Gene: BDP_0716: Zinc uptake regulation protein ZUR
 
Bifidobacterium gallicum DSM 20093

Gene: BIFGAL_01073: Zinc uptake regulation protein ZUR
 
Bifidobacterium longum NCC2705

Gene: BL1128: Zinc uptake regulation protein ZUR
*2
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_1979: Zinc uptake regulation protein ZUR

Site:
position = -45
score = 5.08654
sequence = TAACGATAATGAATATCATTT

Gene: Blon_1974: Zinc uptake regulation protein ZUR
 
Gardnerella vaginalis 409-05

Gene: HMPREF0424_1040: Zinc uptake regulation protein ZUR
Zinc uptake regulation protein ZUR
 
CRON 3.
HMPREF0424_1241
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Bifidobacterium longum subsp. infantis ATCC 15697
*
Gardnerella vaginalis 409-05

Site:
position = -117
score = 5.55319
sequence = TAATGAGAATCATTATTATTA

Gene: HMPREF0424_1241: surface-anchored protein domain protein
surface-anchored protein domain protein
HMPREF0424_1240
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Gardnerella vaginalis 409-05

Gene: HMPREF0424_1240: surface-anchored protein domain protein
surface-anchored protein domain protein
HMPREF0424_1239
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Gardnerella vaginalis 409-05

Gene: HMPREF0424_1239: putative ABC transporter-associated repeat protein
putative ABC transporter-associated repeat protein
znuA3
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Gardnerella vaginalis 409-05

Gene: HMPREF0424_1238: Zinc ABC transporter, periplasmic-binding protein ZnuA
Zinc ABC transporter, periplasmic-binding protein ZnuA
znuC3
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Gardnerella vaginalis 409-05

Gene: HMPREF0424_1237: Zinc ABC transporter, ATP-binding protein ZnuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB3
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Gardnerella vaginalis 409-05

Gene: HMPREF0424_1236: Zinc ABC transporter, inner membrane permease protein ZnuB
Zinc ABC transporter, inner membrane permease protein ZnuB
 
CRON 4.
czcD
*
Bifidobacterium adolescentis ATCC 15703

Site:
position = -60
score = 5.89065
sequence = TATTGAGAAGCGGTTTCAATA

Gene: BAD_1116: Cobalt-zinc-cadmium resistance protein CzcD
*
Bifidobacterium angulatum DSM 20098

Site:
position = -42
score = 5.50982
sequence = TACTGAGAAGCAGTCTCATCT

Gene: BIFANG_00989: Cobalt-zinc-cadmium resistance protein CzcD
 
Bifidobacterium animalis subsp. lactis AD011

Gene: BLA_0791: Cobalt-zinc-cadmium resistance protein CzcD
*
Bifidobacterium bifidum NCIMB 41171

Site:
position = -57
score = 4.72026
sequence = TATTGAAAATGATTGTAGGAA

Gene: BbifN4_010100002259: Cobalt-zinc-cadmium resistance protein CzcD
*
Bifidobacterium breve DSM 20213

Site:
position = -211
score = 5.47246
sequence = AAATGAGAAGCGGTTTCAACA

Gene: BIFBRE_01806: Cobalt-zinc-cadmium resistance protein CzcD
*
Bifidobacterium dentium Bd1

Site:
position = -128
score = 5.65097
sequence = TATTGAGAAGCGATTTCAGTT

Gene: BDP_1557: Cobalt-zinc-cadmium resistance protein CzcD
 
Bifidobacterium gallicum DSM 20093

Gene: BIFGAL_00304: Cobalt-zinc-cadmium resistance protein CzcD
*
Bifidobacterium longum NCC2705

Site:
position = -42
score = 5.37576
sequence = AAATGAGAAGCGGTTTCAACT

Gene: BL1309: Cobalt-zinc-cadmium resistance protein CzcD
*
Bifidobacterium longum subsp. infantis ATCC 15697

Site:
position = -42
score = 5.65494
sequence = TATTGAGAAGCGGTTTCAACT

Gene: Blon_0841: Cobalt-zinc-cadmium resistance protein CzcD
 
Gardnerella vaginalis 409-05

Gene: HMPREF0424_0669: Cobalt-zinc-cadmium resistance protein CzcD
Cobalt-zinc-cadmium resistance protein CzcD
 
CRON 5.
znuC
*
Bifidobacterium adolescentis ATCC 15703

Site:
position = -65
score = 6.59119
sequence = TATTGAGAATGATTGTCAACA

Gene: BAD_0671: Zinc ABC transporter, ATP-binding protein ZnuC
*
Bifidobacterium angulatum DSM 20098

Site:
position = -27
score = 5.93778
sequence = TATTGAAAACGATTGTCAGCA

Gene: BIFANG_01134: Zinc ABC transporter, ATP-binding protein ZnuC
*
Bifidobacterium animalis subsp. lactis AD011

Site:
position = -100
score = 6.73021
sequence = TATTGAGAATGATTGTCAATA

Gene: BLA_1501: Zinc ABC transporter, ATP-binding protein ZnuC
*
Bifidobacterium bifidum NCIMB 41171

Site:
position = -101
score = 5.77441
sequence = TAATGAGAATGATTGTCATAG

Gene: BbifN4_010100003314: Zinc ABC transporter, ATP-binding protein ZnuC
*
Bifidobacterium breve DSM 20213

Site:
position = -43
score = 6.28976
sequence = TATTGAGAACGATTGTCAGCA

Gene: BIFBRE_01043: Zinc ABC transporter, ATP-binding protein ZnuC
*
Bifidobacterium dentium Bd1

Site:
position = -68
score = 6.43906
sequence = TATTGAGAATGGTTGTCAACA

Gene: BDP_0897: Zinc ABC transporter, ATP-binding protein ZnuC
*
Bifidobacterium gallicum DSM 20093

Site:
position = -103
score = 6.04165
sequence = AAATGGGAATGATTGTCAATA

Gene: BIFGAL_00364: Zinc ABC transporter, ATP-binding protein ZnuC
 
Bifidobacterium longum NCC2705

Gene: BL0995: Zinc ABC transporter, ATP-binding protein ZnuC
*
Bifidobacterium longum subsp. infantis ATCC 15697

Site:
position = -43
score = 6.28976
sequence = TATTGAGAACGATTGTCAGCA

Gene: Blon_1757: Zinc ABC transporter, ATP-binding protein ZnuC
 
Gardnerella vaginalis 409-05
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
 
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_0670: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Bifidobacterium angulatum DSM 20098

Gene: BIFANG_01133: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Bifidobacterium animalis subsp. lactis AD011

Gene: BLA_1502: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Bifidobacterium bifidum NCIMB 41171

Gene: BbifN4_010100003309: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Bifidobacterium breve DSM 20213

Gene: BIFBRE_01042: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Bifidobacterium dentium Bd1

Gene: BDP_0896: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Bifidobacterium gallicum DSM 20093

Gene: BIFGAL_00365: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Bifidobacterium longum NCC2705

Gene: BL0996: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_1758: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Gardnerella vaginalis 409-05
Zinc ABC transporter, inner membrane permease protein ZnuB
 
CRON 6.
znuA
*
Bifidobacterium adolescentis ATCC 15703

Site:
position = -27
score = 6.10909
sequence = TGTTGAGAATCATTCTCAGTT

Gene: BAD_0282: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Bifidobacterium angulatum DSM 20098

Site:
position = -150
score = 5.7589
sequence = TACTGATAACGGTTCTCATTT

Gene: BIFANG_00140: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Bifidobacterium animalis subsp. lactis AD011

Site:
position = -100
score = 6.15275
sequence = TATTGAGAACGATTCTCACTT

Gene: BLA_0332: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Bifidobacterium bifidum NCIMB 41171

Site:
position = -89
score = 6.04699
sequence = TAATGATAATAAATCTCAATA

Gene: BbifN4_010100006401: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Bifidobacterium breve DSM 20213

Site:
position = -287
score = 6.1442
sequence = AAATGATAATAATTCTCAATA

Gene: BIFBRE_00824: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Bifidobacterium dentium Bd1

Site:
position = -67
score = 6.06726
sequence = TGTTGAGAATCATTCTCATTT

Gene: BDP_0392: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Bifidobacterium gallicum DSM 20093

Site:
position = -285
score = 5.92483
sequence = TACTGATAATCATTATCAATT

Gene: BIFGAL_00753: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Bifidobacterium longum NCC2705

Site:
position = -112
score = 6.1442
sequence = AAATGATAATAATTCTCAATA

Gene: BL1126: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Bifidobacterium longum subsp. infantis ATCC 15697

Site:
position = -113
score = 6.1442
sequence = AAATGATAATAATTCTCAATA

Gene: Blon_1963: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Gardnerella vaginalis 409-05
Zinc ABC transporter, periplasmic-binding protein ZnuA
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD