Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HrcA - Bifidobacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 39 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bifidobacterium adolescentis ATCC 15703 4 3
Bifidobacterium angulatum DSM 20098 2 2
Bifidobacterium animalis subsp. lactis AD011 4 3
Bifidobacterium bifidum NCIMB 41171 4 3
Bifidobacterium breve DSM 20213 4 3
Bifidobacterium dentium Bd1 4 3
Bifidobacterium gallicum DSM 20093 4 3
Bifidobacterium longum NCC2705 4 3
Bifidobacterium longum subsp. infantis ATCC 15697 4 3
Gardnerella vaginalis 409-05 2 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
groL
*
Bifidobacterium adolescentis ATCC 15703

Site:
position = -137
score = 7.00171
sequence = TTGGCACTCTCGACGTGAGAGTGCTAA

Site:
position = -102
score = 7.06577
sequence = TTAGCACTCGACGAGTGAGAGTGATAA

Gene: BAD_0565: Heat shock protein 60 family chaperone GroEL
*
Bifidobacterium angulatum DSM 20098

Site:
position = -95
score = 7.15173
sequence = TTGGCACTCTCGCACCTTGAGTGCTAA

Site:
position = -60
score = 7.13507
sequence = TTAGCACTCAAGGTGCGAGAGTGATAA

Gene: BIFANG_00586: Heat shock protein 60 family chaperone GroEL
*
Bifidobacterium animalis subsp. lactis AD011

Site:
position = -116
score = 7.08243
sequence = TTGGCACTCGACCACTGAGAGTGCTAA

Gene: BLA_1183: Heat shock protein 60 family chaperone GroEL
*
Bifidobacterium bifidum NCIMB 41171

Site:
position = -142
score = 7.29808
sequence = TTGGCACTCGGGCACCGAGAGTGCTAA

Site:
position = -107
score = 6.45657
sequence = TTAGCACTCGGGGAGTGAGAGTGACAG

Gene: BbifN4_010100002804: Heat shock protein 60 family chaperone GroEL
*
Bifidobacterium breve DSM 20213

Site:
position = -111
score = 7.0116
sequence = TTAGCACTCGGAGATCGAGAGTGATAA

Site:
position = -146
score = 6.96599
sequence = TTGGCACTCGGCAAGGGCGAGTGCTAA

Gene: BIFBRE_00532: Heat shock protein 60 family chaperone GroEL
*
Bifidobacterium dentium Bd1

Site:
position = -140
score = 7.24151
sequence = TTGGCACTCGAGGCCCGAGAGTGCTAA

Site:
position = -104
score = 7.1641
sequence = TTAGCACTCGAGGAGTGAGAGTGATAA

Gene: BDP_0772: Heat shock protein 60 family chaperone GroEL
*
Bifidobacterium gallicum DSM 20093

Site:
position = -134
score = 7.04556
sequence = TTGGCACTCGACCAAGGAGAGTGCTAA

Site:
position = -98
score = 7.10578
sequence = TTAGCACTCGAGGCGTGAGAGTGATAA

Gene: BIFGAL_01875: Heat shock protein 60 family chaperone GroEL
*
Bifidobacterium longum NCC2705

Site:
position = -62
score = 5.23772
sequence = TCACGACTCGACGCTTGCGAGTGATAA

Site:
position = -110
score = 6.95328
sequence = TTAGCACTCGGAGGTCGAGAGTGATAA

Site:
position = -145
score = 7.12046
sequence = TTGGCACTCGGCGGGCGCGAGTGCTAA

Gene: BL0002: Heat shock protein 60 family chaperone GroEL
*
Bifidobacterium longum subsp. infantis ATCC 15697

Site:
position = -145
score = 6.98786
sequence = TTGGCACTCGGCGGTCGCGAGTGCTAA

Site:
position = -62
score = 5.23772
sequence = TCACGACTCGACGCTTGCGAGTGATAA

Site:
position = -110
score = 6.95328
sequence = TTAGCACTCGGAGGTCGAGAGTGATAA

Gene: Blon_0694: Heat shock protein 60 family chaperone GroEL
*
Gardnerella vaginalis 409-05

Site:
position = -95
score = 6.82507
sequence = TTAGCACTCAAGCCTTGAGAGTGATAA

Site:
position = -130
score = 6.97715
sequence = TTGGCACTCGGGTACATAGAGTGCTAA

Gene: HMPREF0424_0717: Heat shock protein 60 family chaperone GroEL
Heat shock protein 60 family chaperone GroEL
 
CRON 2.
hrcA
*
Bifidobacterium adolescentis ATCC 15703

Site:
position = -115
score = 7.12255
sequence = TTAGCACTCCGGGCGCCGGAGTGCTAA

Gene: BAD_0828: Heat-inducible transcription repressor HrcA
 
Bifidobacterium angulatum DSM 20098

Gene: BIFANG_01435: Heat-inducible transcription repressor HrcA
*
Bifidobacterium animalis subsp. lactis AD011

Site:
position = -62
score = 6.92687
sequence = TTAGCACTCCTGTATGCAGAGTGCTAA

Gene: BLA_1356: Heat-inducible transcription repressor HrcA
*
Bifidobacterium bifidum NCIMB 41171

Site:
position = -152
score = 6.92272
sequence = TTAGCACTCAAGGGCAAAGAGTGCTAA

Gene: BbifN4_010100004769: Heat-inducible transcription repressor HrcA
*
Bifidobacterium breve DSM 20213

Site:
position = -95
score = 6.65009
sequence = TTAGCACTCGAAACCAATGAGTGCTAA

Gene: BIFBRE_01333: Heat-inducible transcription repressor HrcA
*
Bifidobacterium dentium Bd1

Site:
position = -138
score = 6.86422
sequence = TTAGCACTCCTCGGCCGGGAGTGCTAA

Gene: BDP_1146: Heat-inducible transcription repressor HrcA
*
Bifidobacterium gallicum DSM 20093

Site:
position = -274
score = 7.36243
sequence = TTAGCACTCTGGCGCCAAGAGTGCTAA

Gene: BIFGAL_01682: Heat-inducible transcription repressor HrcA
*
Bifidobacterium longum NCC2705

Site:
position = -191
score = 6.63919
sequence = TTAGCACTCAAGCCTAAGGAGTGCTAA

Gene: BL0718: Heat-inducible transcription repressor HrcA
*
Bifidobacterium longum subsp. infantis ATCC 15697

Site:
position = -191
score = 6.63919
sequence = TTAGCACTCAAGCCTAAGGAGTGCTAA

Gene: Blon_1097: Heat-inducible transcription repressor HrcA
 
Gardnerella vaginalis 409-05

Gene: HMPREF0424_0901: Heat-inducible transcription repressor HrcA
Heat-inducible transcription repressor HrcA
dnaJ
 
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_0827: Chaperone protein DnaJ
 
Bifidobacterium angulatum DSM 20098

Gene: BIFANG_01434: Chaperone protein DnaJ
 
Bifidobacterium animalis subsp. lactis AD011

Gene: BLA_1355: Chaperone protein DnaJ
 
Bifidobacterium bifidum NCIMB 41171

Gene: BbifN4_010100004764: Chaperone protein DnaJ
 
Bifidobacterium breve DSM 20213

Gene: BIFBRE_01334: Chaperone protein DnaJ
 
Bifidobacterium dentium Bd1

Gene: BDP_1147: Chaperone protein DnaJ
 
Bifidobacterium gallicum DSM 20093

Gene: BIFGAL_01681: Chaperone protein DnaJ
 
Bifidobacterium longum NCC2705

Gene: BL0719: Chaperone protein DnaJ
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_1098: Chaperone protein DnaJ
 
Gardnerella vaginalis 409-05

Gene: HMPREF0424_0900: Chaperone protein DnaJ
Chaperone protein DnaJ
 
CRON 3.
groS
*
Bifidobacterium adolescentis ATCC 15703

Site:
position = -146
score = 7.38014
sequence = TTAGCACTCGAGTTGGCAGAGTGCTAA

Gene: BAD_0292: Heat shock protein 60 family co-chaperone GroES
*
Bifidobacterium angulatum DSM 20098

Site:
position = -142
score = 7.38014
sequence = TTAGCACTCGAGTTGGCAGAGTGCTAA

Gene: BIFANG_00124: Heat shock protein 60 family co-chaperone GroES
*
Bifidobacterium animalis subsp. lactis AD011

Site:
position = -137
score = 7.38014
sequence = TTAGCACTCGAGTTGGCAGAGTGCTAA

Gene: BLA_0343: Heat shock protein 60 family co-chaperone GroES
*
Bifidobacterium bifidum NCIMB 41171

Site:
position = -150
score = 6.92141
sequence = TTAGCAGTCGAGTTGGCAGAGTGCTAA

Gene: BbifN4_010100007652: Heat shock protein 60 family co-chaperone GroES
*
Bifidobacterium breve DSM 20213

Site:
position = -138
score = 7.38014
sequence = TTAGCACTCGAGTTGGCAGAGTGCTAA

Gene: BIFBRE_00229: Heat shock protein 60 family co-chaperone GroES
*
Bifidobacterium dentium Bd1

Site:
position = -147
score = 7.38014
sequence = TTAGCACTCGAGTTGGCAGAGTGCTAA

Gene: BDP_0405: Heat shock protein 60 family co-chaperone GroES
*
Bifidobacterium gallicum DSM 20093

Site:
position = -167
score = 7.24292
sequence = TTAGCACTCGAATTGGCAGAGTGCTAA

Gene: BIFGAL_00768: Heat shock protein 60 family co-chaperone GroES
*
Bifidobacterium longum NCC2705

Site:
position = -140
score = 7.38014
sequence = TTAGCACTCGAGTTGGCAGAGTGCTAA

Gene: BL1558: Heat shock protein 60 family co-chaperone GroES
*
Bifidobacterium longum subsp. infantis ATCC 15697

Site:
position = -140
score = 7.38014
sequence = TTAGCACTCGAGTTGGCAGAGTGCTAA

Gene: Blon_2257: Heat shock protein 60 family co-chaperone GroES
*
Gardnerella vaginalis 409-05

Site:
position = -140
score = 7.36115
sequence = TTAGCACTCGAGTTGTTAGAGTGCTAA

Gene: HMPREF0424_0234: Heat shock protein 60 family co-chaperone GroES
Heat shock protein 60 family co-chaperone GroES
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD