Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog BgrT7 - Bifidobacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode:
Biological process: Galactosides utilization
Effector:
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 9 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bifidobacterium adolescentis ATCC 15703
Bifidobacterium angulatum DSM 20098
Bifidobacterium animalis subsp. lactis AD011
Bifidobacterium bifidum NCIMB 41171
Bifidobacterium breve DSM 20213
Bifidobacterium dentium Bd1 4 3
Bifidobacterium gallicum DSM 20093
Bifidobacterium longum NCC2705
Bifidobacterium longum subsp. infantis ATCC 15697
Gardnerella vaginalis 409-05
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
BDP_1668
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
*
Bifidobacterium dentium Bd1

Site:
position = -148
score = 5.23649
sequence = AAGTTATCAACCAGTAAGTT

Site:
position = -126
score = 5.50589
sequence = TAGTTAGTAATCAATAACAA

Site:
position = -133
score = 4.80258
sequence = AAGTTACTAGTTAGTAATCA

Gene: BDP_1668: Hypothetical protein
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Gardnerella vaginalis 409-05
Hypothetical protein
lacS
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1

Gene: BDP_1667: Galactoside symporter
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Gardnerella vaginalis 409-05
Galactoside symporter
 
CRON 2.
bgrT7
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
*
Bifidobacterium dentium Bd1

Site:
position = -167
score = 5.1943
sequence = TGGTTACTACCAGATAACTT

Site:
position = -145
score = 5.59532
sequence = AAGTTAGCTACCGATAACTT

Site:
position = -52
score = 5.16459
sequence = TAATTATTAATTGGTAACTT

Gene: BDP_1669: Predicted beta-galactoside specific transcriptional regulator, TetR family
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Gardnerella vaginalis 409-05
Predicted beta-galactoside specific transcriptional regulator, TetR family
 
CRON 3.
bgaT2
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
*
Bifidobacterium dentium Bd1

Site:
position = -84
score = 5.1943
sequence = AAGTTATCTGGTAGTAACCA

Site:
position = -199
score = 5.16459
sequence = AAGTTACCAATTAATAATTA

Site:
position = -106
score = 5.59532
sequence = AAGTTATCGGTAGCTAACTT

Gene: BDP_1670: Predicted beta-galactoside permease, MFS family
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Gardnerella vaginalis 409-05
Predicted beta-galactoside permease, MFS family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD