Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog BgrT6 - Bifidobacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode:
Biological process: Galactosides utilization
Effector:
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bifidobacterium adolescentis ATCC 15703 2 2
Bifidobacterium angulatum DSM 20098
Bifidobacterium animalis subsp. lactis AD011
Bifidobacterium bifidum NCIMB 41171
Bifidobacterium breve DSM 20213
Bifidobacterium dentium Bd1
Bifidobacterium gallicum DSM 20093
Bifidobacterium longum NCC2705
Bifidobacterium longum subsp. infantis ATCC 15697
Gardnerella vaginalis 409-05
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
bgaT
*
Bifidobacterium adolescentis ATCC 15703

Site:
position = -158
score = 6.97915
sequence = TATCTTATATCTTTAAGATA

Site:
position = -151
score = 6.80597
sequence = TATCTTTAAGATATAAGATA

Gene: BAD_1206: Predicted beta-galactoside permease, MFS family
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011

Gene: BLA_0045: Predicted beta-galactoside permease, MFS family
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Gardnerella vaginalis 409-05
Predicted beta-galactoside permease, MFS family
 
CRON 2.
bgrT6
*
Bifidobacterium adolescentis ATCC 15703

Site:
position = -101
score = 6.80597
sequence = TATCTTATATCTTAAAGATA

Site:
position = -94
score = 6.97915
sequence = TATCTTAAAGATATAAGATA

Gene: BAD_1207: Predicted beta-galactoside specific transcriptional regulator, TetR family
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Gardnerella vaginalis 409-05
Predicted beta-galactoside specific transcriptional regulator, TetR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD