Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog BgrT5 - Bifidobacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode:
Biological process: Cellobiose utilization
Effector:
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bifidobacterium adolescentis ATCC 15703 1 1
Bifidobacterium angulatum DSM 20098
Bifidobacterium animalis subsp. lactis AD011
Bifidobacterium bifidum NCIMB 41171
Bifidobacterium breve DSM 20213
Bifidobacterium dentium Bd1 1 1
Bifidobacterium gallicum DSM 20093
Bifidobacterium longum NCC2705
Bifidobacterium longum subsp. infantis ATCC 15697
Gardnerella vaginalis 409-05
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
cbpA
*
Bifidobacterium adolescentis ATCC 15703

Site:
position = -107
score = 7.05255
sequence = TTATTTATAAGTTTATAAACAA

Gene: BAD_0439: Cellobiose phosphorylase (EC 2.4.1.20)
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011

Gene: BLA_0623: Cellobiose phosphorylase (EC 2.4.1.20)
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
*
Bifidobacterium dentium Bd1

Site:
position = -146
score = 7.65887
sequence = TTATTTATAAAGTTATAAATAA

Gene: BDP_2127: Cellobiose phosphorylase (EC 2.4.1.20)
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Gardnerella vaginalis 409-05
Cellobiose phosphorylase (EC 2.4.1.20)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD