Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ManR - Staphylococcaceae

Properties
Regulator type: Transcription factor
Regulator family: BglG
Regulation mode: activator
Biological process: Mannose utilization
Effector: ManP, mannose-specific enzyme IIBCA PTS component; HPr, phosphocarrier protein
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Staphylococcus aureus subsp. aureus N315 2 1
Staphylococcus capitis SK14 2 1
Staphylococcus epidermidis ATCC 12228 2 1
Staphylococcus carnosus subsp. carnosus TM300 2 1
Staphylococcus haemolyticus JCSC1435
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
Macrococcus caseolyticus JCSC5402
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
manP
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -76
score = 6.67401
sequence = ATTGCCACTAGTAACGGTAAT

Gene: SA2434: PTS system, mannose-specific IIB component (EC 2.7.1.69) / PTS system, mannose-specific IIC component (EC 2.7.1.69) / PTS system, mannose-specific IIA component (EC 2.7.1.69)
*
Staphylococcus capitis SK14

Site:
position = -80
score = 6.97528
sequence = ATTGCCACTAATAACGGCAAT

Gene: STACA0001_1506: PTS system, mannose-specific IIB component (EC 2.7.1.69) / PTS system, mannose-specific IIC component (EC 2.7.1.69) / PTS system, mannose-specific IIA component (EC 2.7.1.69)
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -85
score = 6.67401
sequence = ATTGCCACTATTGACGGCAAT

Gene: SE2228: PTS system, mannose-specific IIB component (EC 2.7.1.69) / PTS system, mannose-specific IIC component (EC 2.7.1.69) / PTS system, mannose-specific IIA component (EC 2.7.1.69)
*
Staphylococcus carnosus subsp. carnosus TM300

Site:
position = -79
score = 6.97528
sequence = ATTGCCACTAGTAACGGCAAT

Gene: Sca_2440: PTS system, mannose-specific IIB component (EC 2.7.1.69) / PTS system, mannose-specific IIC component (EC 2.7.1.69) / PTS system, mannose-specific IIA component (EC 2.7.1.69)
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
 
Macrococcus caseolyticus JCSC5402
PTS system, mannose-specific IIB component (EC 2.7.1.69) / PTS system, mannose-specific IIC component (EC 2.7.1.69) / PTS system, mannose-specific IIA component (EC 2.7.1.69)
manA
 
Staphylococcus aureus subsp. aureus N315

Gene: SA2435: Mannose-6-phosphate isomerase (EC 5.3.1.8)
 
Staphylococcus capitis SK14

Gene: STACA0001_1507: Mannose-6-phosphate isomerase (EC 5.3.1.8)
 
Staphylococcus epidermidis ATCC 12228

Gene: SE2229: Mannose-6-phosphate isomerase (EC 5.3.1.8)
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_2439: Mannose-6-phosphate isomerase (EC 5.3.1.8)
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
 
Macrococcus caseolyticus JCSC5402
Mannose-6-phosphate isomerase (EC 5.3.1.8)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD