Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ThiR - Sulfolobales

Properties
Regulator type: Transcription factor
Regulator family: [Other]
Regulation mode: repressor
Biological process: Thiamine transport; Thiamine biosynthesis
Effector: Thiamine phosphate
Phylum: Crenarchaeota
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 13 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Metallosphaera sedula DSM 5348 2 2
Sulfolobus acidocaldarius DSM 639 3 3
Sulfolobus islandicus Y.N.15.51 3 3
Sulfolobus solfataricus P2 3 3
Sulfolobus tokodaii str. 7 2 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
thiC
*
Metallosphaera sedula DSM 5348

Site:
position = -18
score = 5.83544
sequence = CTTATAACTTACTTTATAAT

Gene: Msed_0906: Thiamin biosynthesis protein ThiC
*
Sulfolobus acidocaldarius DSM 639

Site:
position = -30
score = 5.21345
sequence = TTTATAATCTAGTTTATTGA

Gene: Saci_0137: Thiamin biosynthesis protein ThiC
 
Sulfolobus islandicus Y.N.15.51
 
Sulfolobus solfataricus P2

Gene: SSO1324: Thiamin biosynthesis protein ThiC
 
Sulfolobus tokodaii str. 7

Gene: ST1864: Thiamin biosynthesis protein ThiC
Thiamin biosynthesis protein ThiC
 
CRON 2.
thiT
 
Metallosphaera sedula DSM 5348

Gene: Msed_0254: Predicted thiamin transporter ThiT
*
Sulfolobus acidocaldarius DSM 639

Site:
position = -42
score = 5.25491
sequence = AATATAACTAACTTTATAAC

Gene: Saci_2110: Predicted thiamin transporter ThiT
*
Sulfolobus islandicus Y.N.15.51

Site:
position = -42
score = 5.28738
sequence = AAAATAAGTGACTTTATAAG

Gene: YN1551_2514: Predicted thiamin transporter ThiT
*
Sulfolobus solfataricus P2

Site:
position = -42
score = 5.28738
sequence = AAAATAAGTGACTTTATAAG

Gene: SSO1593: Predicted thiamin transporter ThiT
*
Sulfolobus tokodaii str. 7

Site:
position = -42
score = 5.57791
sequence = CATATAAGTAGGTTTATAAG

Gene: ST1132: Predicted thiamin transporter ThiT
Predicted thiamin transporter ThiT
 
CRON 3.
tenA
 
Metallosphaera sedula DSM 5348
 
Sulfolobus acidocaldarius DSM 639

Gene: Saci_2283: Thiaminase
*
Sulfolobus islandicus Y.N.15.51

Site:
position = -41
score = 5.47183
sequence = CTTATAAAATGATTTATAAT

Gene: YN1551_2613: Thiaminase
*
Sulfolobus solfataricus P2

Site:
position = -41
score = 5.5992
sequence = GTTATAAAATAATTTATAAT

Gene: SSO2089: Thiaminase
 
Sulfolobus tokodaii str. 7
Thiaminase
 
CRON 4.
thi4
*
Metallosphaera sedula DSM 5348

Site:
position = -42
score = 6.073
sequence = TTTATAACTTAGTTTATAAG

Gene: Msed_2221: Thiazole biosynthetic enzyme Thi4
*
Sulfolobus acidocaldarius DSM 639

Site:
position = -38
score = 5.67163
sequence = CATATAAGTGAGTTTATAAC

Gene: Saci_0854: Thiazole biosynthetic enzyme Thi4
*
Sulfolobus islandicus Y.N.15.51

Site:
position = -41
score = 5.72907
sequence = TATAAAAGTTAATTTATAAG

Gene: YN1551_1140: Thiazole biosynthetic enzyme Thi4
*
Sulfolobus solfataricus P2

Site:
position = -41
score = 5.72907
sequence = TATAAAAGTTAATTTATAAG

Gene: SSO0436: Thiazole biosynthetic enzyme Thi4
*
Sulfolobus tokodaii str. 7

Site:
position = -31
score = 5.44723
sequence = TATATTAGCTAGTTTATAAT

Gene: ST0361: Thiazole biosynthetic enzyme Thi4
Thiazole biosynthetic enzyme Thi4
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD