Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog MalR - Staphylococcaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Staphylococcus aureus subsp. aureus N315 9 2
Staphylococcus capitis SK14
Staphylococcus epidermidis ATCC 12228
Staphylococcus carnosus subsp. carnosus TM300
Staphylococcus haemolyticus JCSC1435 2 1
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 2 1
Macrococcus caseolyticus JCSC5402 10 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
mdxE
 
Staphylococcus aureus subsp. aureus N315

Gene: SA0207: Maltose/maltodextrin ABC transporter, substrate binding protein
 
Staphylococcus capitis SK14
 
Staphylococcus epidermidis ATCC 12228
 
Staphylococcus carnosus subsp. carnosus TM300
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
*
Macrococcus caseolyticus JCSC5402

Site:
position = -110
score = 6.66683
sequence = TTATGCAATCGTTTGCAAAA

Gene: MCCL_0353: Maltose/maltodextrin ABC transporter, substrate binding protein
Maltose/maltodextrin ABC transporter, substrate binding protein
mdxF
 
Staphylococcus aureus subsp. aureus N315

Gene: SA0208: Maltose/maltodextrin ABC transporter, permease protein
 
Staphylococcus capitis SK14
 
Staphylococcus epidermidis ATCC 12228
 
Staphylococcus carnosus subsp. carnosus TM300
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_0354: Maltose/maltodextrin ABC transporter, permease protein
Maltose/maltodextrin ABC transporter, permease protein
mdxG
 
Staphylococcus aureus subsp. aureus N315

Gene: SA0209: Maltose/maltodextrin ABC transporter, permease protein
 
Staphylococcus capitis SK14
 
Staphylococcus epidermidis ATCC 12228
 
Staphylococcus carnosus subsp. carnosus TM300
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_0355: Maltose/maltodextrin ABC transporter, permease protein
Maltose/maltodextrin ABC transporter, permease protein
malR
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -112
score = 6.90263
sequence = TTATGCAATCGTTTGCACAA

Gene: SA1339: Maltose operon transcriptional repressor MalR, LacI family
 
Staphylococcus capitis SK14
 
Staphylococcus epidermidis ATCC 12228
 
Staphylococcus carnosus subsp. carnosus TM300
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -228
score = 6.55203
sequence = TTATGCAAACGATTGCATTA

Gene: SH1407: Maltose operon transcriptional repressor MalR, LacI family
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -106
score = 6.42784
sequence = TCGCGCAAACGTTTGCACAA

Gene: SSP1245: Maltose operon transcriptional repressor MalR, LacI family
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_0356: Maltose operon transcriptional repressor MalR, LacI family
Maltose operon transcriptional repressor MalR, LacI family
MCCL_0357
 
Staphylococcus aureus subsp. aureus N315
 
Staphylococcus capitis SK14
 
Staphylococcus epidermidis ATCC 12228
 
Staphylococcus carnosus subsp. carnosus TM300
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_0357: trehalosemaltose utilization protein
trehalosemaltose utilization protein
gfoA
 
Staphylococcus aureus subsp. aureus N315

Gene: SA0210: putative glucose dehydrogenase A
 
Staphylococcus capitis SK14
 
Staphylococcus epidermidis ATCC 12228
 
Staphylococcus carnosus subsp. carnosus TM300
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_0358: putative glucose dehydrogenase A
putative glucose dehydrogenase A
gfoB
 
Staphylococcus aureus subsp. aureus N315

Gene: SA0211: putative glucose dehydrogenase B
 
Staphylococcus capitis SK14
 
Staphylococcus epidermidis ATCC 12228
 
Staphylococcus carnosus subsp. carnosus TM300
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_0359: putative glucose dehydrogenase B
putative glucose dehydrogenase B
gfoI
 
Staphylococcus aureus subsp. aureus N315

Gene: SA0212: putative sugar isomerase
 
Staphylococcus capitis SK14
 
Staphylococcus epidermidis ATCC 12228
 
Staphylococcus carnosus subsp. carnosus TM300
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_0360: putative sugar isomerase
putative sugar isomerase
mdxK
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -66
score = 6.74219
sequence = TTGTGCAAACGTTTTCACAA

Gene: SA0206: Maltose/maltodextrin transport ATP-binding protein
 
Staphylococcus capitis SK14
 
Staphylococcus epidermidis ATCC 12228
 
Staphylococcus carnosus subsp. carnosus TM300
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_0361: Maltose/maltodextrin transport ATP-binding protein
Maltose/maltodextrin transport ATP-binding protein
malA
 
Staphylococcus aureus subsp. aureus N315

Gene: SA1338: Alpha-glucosidase (EC 3.2.1.20)
 
Staphylococcus capitis SK14
 
Staphylococcus epidermidis ATCC 12228
 
Staphylococcus carnosus subsp. carnosus TM300
 
Staphylococcus haemolyticus JCSC1435

Gene: SH1408: Alpha-glucosidase (EC 3.2.1.20)
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP1246: Alpha-glucosidase (EC 3.2.1.20)
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_0362: Alpha-glucosidase (EC 3.2.1.20)
Alpha-glucosidase (EC 3.2.1.20)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD