Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Blon_0374 - Bifidobacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Carbohydrate metabolism
Effector:
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bifidobacterium longum subsp. infantis ATCC 15697 3 1
Bifidobacterium adolescentis ATCC 15703
Bifidobacterium angulatum DSM 20098
Bifidobacterium animalis subsp. lactis AD011
Bifidobacterium bifidum NCIMB 41171
Bifidobacterium breve DSM 20213
Bifidobacterium dentium Bd1
Bifidobacterium gallicum DSM 20093
Bifidobacterium longum NCC2705
Gardnerella vaginalis 409-05
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
Blon_0375
*
Bifidobacterium longum subsp. infantis ATCC 15697

Site:
position = -36
score = 4.92428
sequence = ATATTGAAGCGTATAACTAA

Site:
position = -106
score = 6.24679
sequence = TAGTTTATGCGCATCAACAC

Site:
position = -52
score = 6.25832
sequence = TCATTTATGCGCATCAATAT

Gene: Blon_0375: ABC transporter, sugar-binding component
 
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_1405: ABC transporter, sugar-binding component
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
ABC transporter, sugar-binding component
Blon_0376
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_0376: ABC transporter, permease component
 
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_1404: ABC transporter, permease component
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
ABC transporter, permease component
Blon_0377
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_0377: ABC transporter, permease component
 
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_1403: ABC transporter, permease component
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
ABC transporter, permease component
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD