Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SgaR2 - Bifidobacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Ascorbate utilization
Effector: Ascorbate-6-phosphate
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bifidobacterium adolescentis ATCC 15703
Bifidobacterium angulatum DSM 20098
Bifidobacterium animalis subsp. lactis AD011
Bifidobacterium bifidum NCIMB 41171 4 2
Bifidobacterium breve DSM 20213
Bifidobacterium dentium Bd1
Bifidobacterium gallicum DSM 20093
Bifidobacterium longum NCC2705
Bifidobacterium longum subsp. infantis ATCC 15697
Gardnerella vaginalis 409-05 7 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
ptsI
 
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_0166: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
 
Bifidobacterium angulatum DSM 20098

Gene: BIFANG_00108: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171

Gene: BbifN4_010100006908: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
 
Bifidobacterium breve DSM 20213

Gene: BIFBRE_01978: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
 
Bifidobacterium dentium Bd1

Gene: BDP_0254: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
 
Bifidobacterium gallicum DSM 20093

Gene: BIFGAL_00157: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
 
Bifidobacterium longum NCC2705
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_0178: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
*
Gardnerella vaginalis 409-05

Site:
position = -140
score = 6.05283
sequence = TACAGAAAACGTTTTCACTT

Gene: HMPREF0424_1268: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
sgaA2
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
*
Bifidobacterium bifidum NCIMB 41171

Site:
position = -137
score = 5.57763
sequence = TTGAGAAATCGGTTTCCGGG

Gene: BbifN4_010100009110: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.69)
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Gardnerella vaginalis 409-05

Gene: HMPREF0424_1267: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.69)
Ascorbate-specific PTS system, EIIA component (EC 2.7.1.69)
sgaB2
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171

Gene: BbifN4_010100009115: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Gardnerella vaginalis 409-05

Gene: HMPREF0424_1266: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
HMPREF0424_1265
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Gardnerella vaginalis 409-05

Gene: HMPREF0424_1265: putative lipoprotein
putative lipoprotein
sgaT2
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171

Gene: BbifN4_010100009120: Ascorbate-specific PTS, EIIC component
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Gardnerella vaginalis 409-05

Gene: HMPREF0424_1264: Ascorbate-specific PTS, EIIC component
Ascorbate-specific PTS, EIIC component
 
CRON 2.
hpr
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098

Gene: BIFANG_00109: Phosphotransferase system, phosphocarrier protein HPr
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171

Gene: BbifN4_010100006903: Phosphotransferase system, phosphocarrier protein HPr
 
Bifidobacterium breve DSM 20213

Gene: BIFBRE_01976: Phosphotransferase system, phosphocarrier protein HPr
 
Bifidobacterium dentium Bd1

Gene: BDP_0253: Phosphotransferase system, phosphocarrier protein HPr
 
Bifidobacterium gallicum DSM 20093

Gene: BIFGAL_00155: Phosphotransferase system, phosphocarrier protein HPr
 
Bifidobacterium longum NCC2705
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_0177: Phosphotransferase system, phosphocarrier protein HPr
*
Gardnerella vaginalis 409-05

Site:
position = -153
score = 6.05283
sequence = AAGTGAAAACGTTTTCTGTA

Gene: HMPREF0424_1269: Phosphotransferase system, phosphocarrier protein HPr
Phosphotransferase system, phosphocarrier protein HPr
sgaR2
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
*
Bifidobacterium bifidum NCIMB 41171

Site:
position = -212
score = 5.57763
sequence = CCCGGAAACCGATTTCTCAA

Gene: BbifN4_010100009105: Predicted transcriptional regulator of ascorbate utilization, LacI family
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Gardnerella vaginalis 409-05

Gene: HMPREF0424_1270: Predicted transcriptional regulator of ascorbate utilization, LacI family
Predicted transcriptional regulator of ascorbate utilization, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD