Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog BgaR - Bifidobacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Galactosides utilization
Effector: Beta-galactosides
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 22 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bifidobacterium longum subsp. infantis ATCC 15697
Bifidobacterium adolescentis ATCC 15703
Bifidobacterium angulatum DSM 20098 2 2
Bifidobacterium animalis subsp. lactis AD011 5 3
Bifidobacterium bifidum NCIMB 41171 3 2
Bifidobacterium breve DSM 20213 2 2
Bifidobacterium dentium Bd1 5 3
Bifidobacterium gallicum DSM 20093
Bifidobacterium longum NCC2705 7 5
Gardnerella vaginalis 409-05
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
bgaY
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
*
Bifidobacterium animalis subsp. lactis AD011

Site:
position = -191
score = 5.16992
sequence = AACTGTTTGCGCAATCATGC

Site:
position = -114
score = 5.89582
sequence = CTATGTTTGCGTAAACATTC

Gene: BLA_0464: Putative beta-galactoside ABC transport system, permease component 2
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
*
Bifidobacterium dentium Bd1

Site:
position = -270
score = 5.09794
sequence = TAATGTTTTCGTCATCATAG

Site:
position = -179
score = 5.52128
sequence = TTCTGATAACGTAAACATTT

Gene: BDP_0655: Putative beta-galactoside ABC transport system, permease component 2
 
Bifidobacterium gallicum DSM 20093
*
Bifidobacterium longum NCC2705

Site:
position = -44
score = 5.83258
sequence = TGATGATAACGCAAACATTT

Gene: BL1170: Putative beta-galactoside ABC transport system, permease component 2
 
Gardnerella vaginalis 409-05
Putative beta-galactoside ABC transport system, permease component 2
bgaZ
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011

Gene: BLA_0463: Putative beta-galactoside ABC transport system, permease component 1
*
Bifidobacterium bifidum NCIMB 41171

Site:
position = -200
score = 4.67111
sequence = CTATGTTTTGGTTACCATCA

Site:
position = -118
score = 5.66184
sequence = TCATGGTAACGCAAACATTT

Gene: BbifN4_010100008756: Putative beta-galactoside ABC transport system, permease component 1
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1

Gene: BDP_0656: Putative beta-galactoside ABC transport system, permease component 1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705

Gene: BL1169: Putative beta-galactoside ABC transport system, permease component 1
 
Gardnerella vaginalis 409-05
Putative beta-galactoside ABC transport system, permease component 1
bgaB
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_2016: Beta-galactosidase (EC 3.2.1.23)
 
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_1603: Beta-galactosidase (EC 3.2.1.23)
*
Bifidobacterium angulatum DSM 20098

Site:
position = -124
score = 4.80163
sequence = AAATGGTTTCGTCACCATTT

Site:
position = -35
score = 5.95376
sequence = TAATGATAACGCAAACATTT

Gene: BIFANG_00302: Beta-galactosidase (EC 3.2.1.23)
 
Bifidobacterium animalis subsp. lactis AD011

Gene: BLA_0462: Beta-galactosidase (EC 3.2.1.23)
 
Bifidobacterium bifidum NCIMB 41171

Gene: BbifN4_010100008761: Beta-galactosidase (EC 3.2.1.23)
 
Bifidobacterium breve DSM 20213

Gene: BIFBRE_00763: Beta-galactosidase (EC 3.2.1.23)
 
Bifidobacterium dentium Bd1

Gene: BDP_0657: Beta-galactosidase (EC 3.2.1.23)
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705

Gene: BL1168: Beta-galactosidase (EC 3.2.1.23)
 
Gardnerella vaginalis 409-05
Beta-galactosidase (EC 3.2.1.23)
bgaX
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
*
Bifidobacterium animalis subsp. lactis AD011

Site:
position = -83
score = 6.37323
sequence = ATATGTTTGCGCAAACATAA

Gene: BLA_0461: Putative beta-galactoside ABC transport system, periplasmic component
 
Bifidobacterium bifidum NCIMB 41171
*
Bifidobacterium breve DSM 20213

Site:
position = -156
score = 5.27378
sequence = AGATGTTATCGCAACCATAG

Gene: BIFBRE_00764: Putative beta-galactoside ABC transport system, periplasmic component
*
Bifidobacterium dentium Bd1

Site:
position = -124
score = 6.03983
sequence = TTTTGTTTGCGTAAACATAT

Gene: BDP_0659: Putative beta-galactoside ABC transport system, periplasmic component
 
Bifidobacterium gallicum DSM 20093
*2
Bifidobacterium longum NCC2705

Site:
position = -170
score = 5.27378
sequence = AGATGTTATCGCAACCATAG

Gene: BL1164: Putative beta-galactoside ABC transport system, periplasmic component

Site:
position = -108
score = 5.79325
sequence = TCGTGTTTGCGTAAACATAA

Gene: BL1165: Putative beta-galactoside ABC transport system, periplasmic component
 
Gardnerella vaginalis 409-05
Putative beta-galactoside ABC transport system, periplasmic component
 
CRON 2.
bgaR
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
*
Bifidobacterium angulatum DSM 20098

Site:
position = -176
score = 5.95376
sequence = AAATGTTTGCGTTATCATTA

Gene: BIFANG_00301: Transcriptional regulator for beta-galactosides utilization, LacI family
*
Bifidobacterium animalis subsp. lactis AD011

Site:
position = -174
score = 5.89582
sequence = GAATGTTTACGCAAACATAG

Site:
position = -97
score = 5.16992
sequence = GCATGATTGCGCAAACAGTT

Gene: BLA_0465: Transcriptional regulator for beta-galactosides utilization, LacI family
*
Bifidobacterium bifidum NCIMB 41171

Site:
position = -128
score = 5.66184
sequence = AAATGTTTGCGTTACCATGA

Gene: BbifN4_010100008751: Transcriptional regulator for beta-galactosides utilization, LacI family
*
Bifidobacterium breve DSM 20213

Site:
position = -208
score = 5.49919
sequence = AATTGTTTACGTTATCATCA

Gene: BIFBRE_00761: Transcriptional regulator for beta-galactosides utilization, LacI family
 
Bifidobacterium dentium Bd1

Gene: BDP_0654: Transcriptional regulator for beta-galactosides utilization, LacI family
 
Bifidobacterium gallicum DSM 20093
*
Bifidobacterium longum NCC2705

Site:
position = -192
score = 5.83258
sequence = AAATGTTTGCGTTATCATCA

Gene: BL1171: Transcriptional regulator for beta-galactosides utilization, LacI family
 
Gardnerella vaginalis 409-05
Transcriptional regulator for beta-galactosides utilization, LacI family
 
CRON 3.
abfA1
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
*
Bifidobacterium dentium Bd1

Site:
position = -169
score = 6.03983
sequence = ATATGTTTACGCAAACAAAA

Gene: BDP_0658: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
 
Bifidobacterium gallicum DSM 20093
*
Bifidobacterium longum NCC2705

Site:
position = -71
score = 5.79325
sequence = TTATGTTTACGCAAACACGA

Gene: BL1166: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
 
Gardnerella vaginalis 409-05
Alpha-N-arabinofuranosidase (EC 3.2.1.55)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD