Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog AouR - Bifidobacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Arabinose oligosaccharide utilization
Effector:
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 11 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bifidobacterium longum subsp. infantis ATCC 15697
Bifidobacterium adolescentis ATCC 15703
Bifidobacterium angulatum DSM 20098
Bifidobacterium animalis subsp. lactis AD011 3 2
Bifidobacterium bifidum NCIMB 41171
Bifidobacterium breve DSM 20213
Bifidobacterium dentium Bd1 6 3
Bifidobacterium gallicum DSM 20093
Bifidobacterium longum NCC2705 5 2
Gardnerella vaginalis 409-05
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
aouA
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
*
Bifidobacterium dentium Bd1

Site:
position = -152
score = 4.22024
sequence = TGATGAAATGATTTTGAAAA

Site:
position = -274
score = 4.62708
sequence = ATATGAAACAGTTTTCGCAT

Gene: BDP_1706: Arabinose oligosaccharide ABC transporter, sugar-binding protein
 
Bifidobacterium gallicum DSM 20093
*
Bifidobacterium longum NCC2705

Site:
position = -381
score = 4.41337
sequence = ATGCGAAAACTTTCGCAAAC

Site:
position = -153
score = 3.7964
sequence = TTTTGCAAAAACTTCCATGT

Gene: BL0425: Arabinose oligosaccharide ABC transporter, sugar-binding protein
 
Gardnerella vaginalis 409-05
Arabinose oligosaccharide ABC transporter, sugar-binding protein
aouB
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1

Gene: BDP_1705: Arabinose oligosaccharide ABC transporter, permease protein 1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705

Gene: BL0424: Arabinose oligosaccharide ABC transporter, permease protein 1
 
Gardnerella vaginalis 409-05
Arabinose oligosaccharide ABC transporter, permease protein 1
aouC
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1

Gene: BDP_1704: Arabinose oligosaccharide ABC transporter, permease component 2
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705

Gene: BL0423: Arabinose oligosaccharide ABC transporter, permease component 2
 
Gardnerella vaginalis 409-05
Arabinose oligosaccharide ABC transporter, permease component 2
hypBA1
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
*
Bifidobacterium animalis subsp. lactis AD011

Site:
position = -113
score = 5.30584
sequence = GGAAGGAAATATTTCCCAAC

Gene: BLA_1513: Non-reducing end beta-L-arabinofuranosidase (EC 3.2.1.185)
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213

Gene: BIFBRE_02037: Non-reducing end beta-L-arabinofuranosidase (EC 3.2.1.185)
 
Bifidobacterium dentium Bd1

Gene: BDP_1703: Non-reducing end beta-L-arabinofuranosidase (EC 3.2.1.185)
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705

Gene: BL0422: Non-reducing end beta-L-arabinofuranosidase (EC 3.2.1.185)
 
Gardnerella vaginalis 409-05
Non-reducing end beta-L-arabinofuranosidase (EC 3.2.1.185)
aouT
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011

Gene: BLA_1512: Arabinose oligosaccharide permease
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
Arabinose oligosaccharide permease
 
CRON 2.
aouR
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
*
Bifidobacterium animalis subsp. lactis AD011

Site:
position = -47
score = 5.30584
sequence = GTTGGGAAATATTTCCTTCC

Gene: BLA_1514: Arabinose oligosaccharide utilization transcriptional regulator, LacI family
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
*
Bifidobacterium dentium Bd1

Site:
position = -296
score = 4.22024
sequence = TTTTCAAAATCATTTCATCA

Site:
position = -174
score = 4.62708
sequence = ATGCGAAAACTGTTTCATAT

Gene: BDP_1707: Arabinose oligosaccharide utilization transcriptional regulator, LacI family
 
Bifidobacterium gallicum DSM 20093
*
Bifidobacterium longum NCC2705

Site:
position = -124
score = 4.41337
sequence = GTTTGCGAAAGTTTTCGCAT

Gene: BL0426: Arabinose oligosaccharide utilization transcriptional regulator, LacI family
 
Gardnerella vaginalis 409-05
Arabinose oligosaccharide utilization transcriptional regulator, LacI family
 
CRON 3.
hypBA2
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
*
Bifidobacterium dentium Bd1

Site:
position = -257
score = 4.45808
sequence = AGGAGAAATATTTTTCATAT

Site:
position = -196
score = 4.15031
sequence = TTGTGAAAAAATTTCGCATC

Gene: BDP_1701: Beta-L-arabinobiosidase (EC 3.2.1.187)
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705

Gene: BL0421: Beta-L-arabinobiosidase (EC 3.2.1.187)
 
Gardnerella vaginalis 409-05
Beta-L-arabinobiosidase (EC 3.2.1.187)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD