Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog LexA - Staphylococcaceae

Properties
Regulator type: Transcription factor
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 85 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Staphylococcus aureus subsp. aureus N315 16 10
Staphylococcus capitis SK14 16 10
Staphylococcus epidermidis ATCC 12228 16 10
Staphylococcus carnosus subsp. carnosus TM300 14 8
Staphylococcus haemolyticus JCSC1435 16 10
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 16 10
Macrococcus caseolyticus JCSC5402 8 6
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
SA1738
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -51
score = 5.25912
sequence = AACAGAACACATGTTCGTAT

Gene: SA1738: SPBc2 prophage-derived uncharacterized protein
*
Staphylococcus capitis SK14

Site:
position = -52
score = 5.61283
sequence = AATAGAACAAATGTTCGTAT

Gene: STACA0001_1975: SPBc2 prophage-derived uncharacterized protein
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -52
score = 5.58962
sequence = AACAGAACAAATGTTCGTAT

Gene: SE1605: SPBc2 prophage-derived uncharacterized protein
*
Staphylococcus carnosus subsp. carnosus TM300

Site:
position = -59
score = 5.28476
sequence = TAGCGAACAAGTGTTCGTAT

Gene: Sca_1497: SPBc2 prophage-derived uncharacterized protein
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -39
score = 5.43778
sequence = ATgCGAACATATGTTCtata

Gene: SH0364: SPBc2 prophage-derived uncharacterized protein
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -51
score = 5.58655
sequence = AATAGAACGTATGTTCGTAT

Gene: SSP0868: SPBc2 prophage-derived uncharacterized protein
*
Macrococcus caseolyticus JCSC5402

Site:
position = -34
score = 5.42512
sequence = AACAGAACGTACGTTCGTAT

Gene: MCCL_1665: SPBc2 prophage-derived uncharacterized protein
SPBc2 prophage-derived uncharacterized protein
 
CRON 2.
uvrX
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -79
score = 5.0384
sequence = AACAGAACATTTGTTCTAAA

Site:
position = -51
score = 4.8399
sequence = AATAGAACACGTGTTCGTAT

Gene: SA1196: Putative UV-damage repair protein
*
Staphylococcus capitis SK14

Site:
position = -78
score = 5.00724
sequence = AATAGAACATTCGTTCTTGT

Site:
position = -49
score = 4.91905
sequence = ATAAGAACACGTGTTCTTAT

Gene: STACA0001_1610: Putative UV-damage repair protein
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -77
score = 5.69199
sequence = ATAAGAACAAATGTTCTTAT

Site:
position = -48
score = 4.66791
sequence = AATAGAACACGTGTTCTTAT

Gene: SE1046: Putative UV-damage repair protein
*2
Staphylococcus carnosus subsp. carnosus TM300

Site:
position = -82
score = 5.24598
sequence = AACAGAACATTTGTTCTTTA

Site:
position = -53
score = 5.72686
sequence = ATAAGAACAAATGTTCGCAT

Gene: Sca_1008: Putative UV-damage repair protein

Gene: Sca_1009: Putative UV-damage repair protein
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -81
score = 4.94538
sequence = TAAAGAACATTAGTTCTTAT

Site:
position = -52
score = 5.84219
sequence = AAAAGAACAAATGTTCGTAT

Gene: SH1545: Putative UV-damage repair protein
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -51
score = 5.61283
sequence = AATAGAACATTTGTTCGTAT

Site:
position = -80
score = 5.051
sequence = ATTGGAACATTTGTTCTTAT

Gene: SSP1388: Putative UV-damage repair protein
*
Macrococcus caseolyticus JCSC5402

Site:
position = -10
score = 4.86661
sequence = AATAGAACGTATGTTCTGGT

Site:
position = -38
score = 5.41456
sequence = ATAAGAACATACGTTCTATT

Gene: MCCL_1033: Putative UV-damage repair protein
Putative UV-damage repair protein
 
CRON 3.
uvrB
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -107
score = 5.38665
sequence = TTACGAACAAACGTTTGCTT

Gene: SA0713: excinuclease ABC subunit B
*
Staphylococcus capitis SK14

Site:
position = -126
score = 5.37762
sequence = AAGCGAACAAACGTTTGCTT

Gene: STACA0001_0273: excinuclease ABC subunit B
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -130
score = 5.67474
sequence = AAGCGAACAAATGTTTGTAT

Gene: SE0541: excinuclease ABC subunit B
*
Staphylococcus carnosus subsp. carnosus TM300

Site:
position = -267
score = 4.76508
sequence = CTGCGAACAGATGTTTGTAC

Gene: Sca_0407: excinuclease ABC subunit B
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -266
score = 5.53652
sequence = AAGCGAACAAACGTTTGTAT

Gene: SH2131: excinuclease ABC subunit B
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -176
score = 5.5586
sequence = CTACGAACAAATGTTTGTTT

Gene: SSP1959: excinuclease ABC subunit B
*
Macrococcus caseolyticus JCSC5402

Site:
position = -67
score = 5.33608
sequence = TTACGAACAAATGTTTGTAC

Gene: MCCL_0509: excinuclease ABC subunit B
excinuclease ABC subunit B
uvrA
 
Staphylococcus aureus subsp. aureus N315

Gene: SA0714: exinuclease ABC subunit A
 
Staphylococcus capitis SK14

Gene: STACA0001_0272: exinuclease ABC subunit A
 
Staphylococcus epidermidis ATCC 12228

Gene: SE0542: exinuclease ABC subunit A
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_0408: exinuclease ABC subunit A
 
Staphylococcus haemolyticus JCSC1435

Gene: SH2130: exinuclease ABC subunit A
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP1958: exinuclease ABC subunit A
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_0510: exinuclease ABC subunit A
exinuclease ABC subunit A
 
CRON 4.
sbcD
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -31
score = 5.30406
sequence = AAGCGAACAAATGTTCTATA

Gene: SA1180: exonuclease SbcD
*
Staphylococcus capitis SK14

Site:
position = -33
score = 5.86398
sequence = ATACGAACAAATGTTCTTAT

Gene: STACA0001_1593: exonuclease SbcD
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -33
score = 5.70397
sequence = AAACGAACAAACGTTCTTAT

Gene: SE1028: exonuclease SbcD
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_0987: exonuclease SbcD
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -31
score = 5.18937
sequence = ACACGAACAAATGTTCTAAA

Gene: SH1562: exonuclease SbcD
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -33
score = 5.24314
sequence = ATACGAACAAACGTTCTAAG

Gene: SSP1412: exonuclease SbcD
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_1002: exonuclease SbcD
exonuclease SbcD
sbcC
 
Staphylococcus aureus subsp. aureus N315

Gene: SA1181: exonuclease SbcC
 
Staphylococcus capitis SK14

Gene: STACA0001_1594: exonuclease SbcC
 
Staphylococcus epidermidis ATCC 12228

Gene: SE1029: exonuclease SbcC
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_0988: exonuclease SbcC
 
Staphylococcus haemolyticus JCSC1435

Gene: SH1561: exonuclease SbcC
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP1411: exonuclease SbcC
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_1003: exonuclease SbcC
exonuclease SbcC
 
CRON 5.
SA1975
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -66
score = 4.92942
sequence = ACCCGAAAATATGTTCGTGT

Gene: SA1975: predicted membrane-bound hydrolase
*
Staphylococcus capitis SK14

Site:
position = -65
score = 5.18025
sequence = ACACGAAAGTATGTTCGCTT

Gene: STACA0001_1306: predicted membrane-bound hydrolase
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -66
score = 5.14971
sequence = GTACGAAAGTATGTTCGCAT

Gene: SE1762: predicted membrane-bound hydrolase
*
Staphylococcus carnosus subsp. carnosus TM300

Site:
position = -68
score = 5.12891
sequence = GACCGAAAATATGTTCGTTT

Gene: Sca_1672: predicted membrane-bound hydrolase
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -66
score = 5.24514
sequence = CACCGAAAATATGTTCGTAT

Gene: SH0869: predicted membrane-bound hydrolase
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -66
score = 5.34754
sequence = TTACGAAAGTATGTTCGCAT

Gene: SSP0715: predicted membrane-bound hydrolase
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_0309: predicted membrane-bound hydrolase
predicted membrane-bound hydrolase
SA1974
 
Staphylococcus aureus subsp. aureus N315

Gene: SA1974: UDP-N-acetylglucosamine pyrophosphorylase
 
Staphylococcus capitis SK14

Gene: STACA0001_1307: UDP-N-acetylglucosamine pyrophosphorylase
 
Staphylococcus epidermidis ATCC 12228

Gene: SE1761: UDP-N-acetylglucosamine pyrophosphorylase
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_1671: UDP-N-acetylglucosamine pyrophosphorylase
 
Staphylococcus haemolyticus JCSC1435

Gene: SH0870: UDP-N-acetylglucosamine pyrophosphorylase
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP0716: UDP-N-acetylglucosamine pyrophosphorylase
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_0310: UDP-N-acetylglucosamine pyrophosphorylase
UDP-N-acetylglucosamine pyrophosphorylase
SA1973
 
Staphylococcus aureus subsp. aureus N315

Gene: SA1973: hemolysin III
 
Staphylococcus capitis SK14

Gene: STACA0001_1308: hemolysin III
 
Staphylococcus epidermidis ATCC 12228

Gene: SE1760: hemolysin III
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_1670: hemolysin III
 
Staphylococcus haemolyticus JCSC1435

Gene: SH0871: hemolysin III
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP0717: hemolysin III
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_1812: hemolysin III
hemolysin III
 
CRON 6.
SA1749
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -133
score = 5.70156
sequence = AACAGAACATATGTTCGTAT

Gene: SA1749: hypothetical protein
*
Staphylococcus capitis SK14

Site:
position = -125
score = 5.26613
sequence = TATAGAACATATGTTCGCTA

Gene: STACA0001_1989: hypothetical protein
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -127
score = 5.11699
sequence = AACAGAACGTATGTTCTGTT

Gene: SE1627: hypothetical protein
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_1509: hypothetical protein
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -129
score = 5.85527
sequence = AAACGAACAAATGTTCGCTT

Gene: SH1018: hypothetical protein
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -135
score = 5.1209
sequence = AACAGAACGTGTGTTCGTAT

Gene: SSP0853: hypothetical protein
 
Macrococcus caseolyticus JCSC5402
hypothetical protein
 
CRON 7.
SA0684
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -124
score = 4.77392
sequence = CACAGAACGTTTGTTCGGTA

Gene: SA0684: putative permease
*
Staphylococcus capitis SK14

Site:
position = -123
score = 4.81388
sequence = AACAGAACATGTGTTCGTGA

Gene: STACA0001_0299: putative permease
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -116
score = 5.85527
sequence = AAGCGAACATTTGTTCGTTT

Gene: SE0511: putative permease
*
Staphylococcus carnosus subsp. carnosus TM300

Site:
position = -126
score = 5.45041
sequence = AACAGAACATATGTTCGATT

Gene: Sca_0377: putative permease
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -124
score = 5.58962
sequence = AACAGAACATTTGTTCGTAT

Gene: SH2164: putative permease
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -125
score = 5.14437
sequence = TACAGAACATTTGTTCGTGT

Gene: SSP1988: putative permease
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_0481: putative permease
putative permease
SA0683
 
Staphylococcus aureus subsp. aureus N315

Gene: SA0683: 7-cyano-7-deazaguanine reductase
 
Staphylococcus capitis SK14

Gene: STACA0001_0300: 7-cyano-7-deazaguanine reductase
 
Staphylococcus epidermidis ATCC 12228

Gene: SE0510: 7-cyano-7-deazaguanine reductase
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_0376: 7-cyano-7-deazaguanine reductase
 
Staphylococcus haemolyticus JCSC1435

Gene: SH2165: 7-cyano-7-deazaguanine reductase
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP1989: 7-cyano-7-deazaguanine reductase
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_0480: 7-cyano-7-deazaguanine reductase
7-cyano-7-deazaguanine reductase
 
CRON 8.
recA
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -102
score = 5.37383
sequence = ATACGAACAAATATTCGCAA

Site:
position = -145
score = 5.08341
sequence = ATAAGCACGTTTGTTCGTTT

Gene: SA1128: recombinase A
*
Staphylococcus capitis SK14

Site:
position = -103
score = 5.07845
sequence = ACACGAACAAATATTCGCAA

Site:
position = -146
score = 4.85405
sequence = ATAAGTACGTTTGTTCGATT

Gene: STACA0001_2334: recombinase A
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -102
score = 5.37383
sequence = ATACGAACAAATATTCGCAA

Site:
position = -145
score = 5.08341
sequence = ATAAGTACGTTTGTTCGTTT

Gene: SE0963: recombinase A
*
Staphylococcus carnosus subsp. carnosus TM300

Site:
position = -102
score = 4.98446
sequence = AATCGAACAAACATTCGCAA

Gene: Sca_0926: recombinase A
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -105
score = 5.21492
sequence = AAGCGAACAAATATTCGCAA

Gene: SH1628: recombinase A
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -104
score = 5.06506
sequence = TAGCGAACAAATATTCGCAA

Gene: SSP1480: recombinase A
*
Macrococcus caseolyticus JCSC5402

Site:
position = -132
score = 5.22781
sequence = ATACAAACAGACGTTCGCAT

Gene: MCCL_0875: recombinase A
recombinase A
 
CRON 9.
parE
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -32
score = 5.25698
sequence = AAACGAACGTACGTTTGCAG

Gene: SA1188: DNA topoisomerase IV subunit B
*
Staphylococcus capitis SK14

Site:
position = -33
score = 5.3941
sequence = AAACGAACGTACGTTTGTAG

Gene: STACA0001_1601: DNA topoisomerase IV subunit B
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -33
score = 5.24423
sequence = TAACGAACGTACGTTTGTAG

Gene: SE1036: DNA topoisomerase IV subunit B
*
Staphylococcus carnosus subsp. carnosus TM300

Site:
position = -35
score = 5.38245
sequence = TAACGAACGTATGTTTGTAG

Gene: Sca_0995: DNA topoisomerase IV subunit B
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -32
score = 5.3941
sequence = AAACGAACGTACGTTTGTAG

Gene: SH1554: DNA topoisomerase IV subunit B
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -33
score = 5.3941
sequence = AAACGAACGTACGTTTGTAG

Gene: SSP1404: DNA topoisomerase IV subunit B
*
Macrococcus caseolyticus JCSC5402

Site:
position = -31
score = 5.17488
sequence = TTTCGAACGTATGTTTGTAG

Gene: MCCL_1011: DNA topoisomerase IV subunit B
DNA topoisomerase IV subunit B
parC
 
Staphylococcus aureus subsp. aureus N315

Gene: SA1189: DNA topoisomerase IV subunit A
 
Staphylococcus capitis SK14

Gene: STACA0001_1602: DNA topoisomerase IV subunit A
 
Staphylococcus epidermidis ATCC 12228

Gene: SE1037: DNA topoisomerase IV subunit A
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_0996: DNA topoisomerase IV subunit A
 
Staphylococcus haemolyticus JCSC1435

Gene: SH1553: DNA topoisomerase IV subunit A
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP1403: DNA topoisomerase IV subunit A
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_1012: DNA topoisomerase IV subunit A
DNA topoisomerase IV subunit A
 
CRON 10.
lexA
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -74
score = 5.6402
sequence = TAACGAACAAATGTTTGTTT

Site:
position = -132
score = 4.88366
sequence = CCTAGAACATTTGTTTGTAT

Gene: SA1174: SOS regulatory LexA protein
*
Staphylococcus capitis SK14

Site:
position = -132
score = 4.74544
sequence = CCTAGAACGTTTGTTTGTAT

Site:
position = -103
score = 4.77359
sequence = ATCAGAACGAATGTTCTGTG

Site:
position = -74
score = 5.65185
sequence = AAACGAACAAACGTTTGTTT

Gene: STACA0001_1582: SOS regulatory LexA protein
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -517
score = 4.88366
sequence = cctaGAACATtTGTTtGTAT

Site:
position = -459
score = 5.51212
sequence = tTACGAACAaATGTTtGTta

Gene: SE1022: SOS regulatory LexA protein
*
Staphylococcus carnosus subsp. carnosus TM300

Site:
position = -132
score = 4.72333
sequence = CCCAGAACATTTGTTTGCAT

Site:
position = -103
score = 4.94909
sequence = ATCAGAACGATTGTTCGCTG

Site:
position = -74
score = 5.53391
sequence = TTACGAACAAATGTTTGTAA

Gene: Sca_0980: SOS regulatory LexA protein
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -132
score = 4.98705
sequence = TCTAGAACATTTGTTTGTAT

Site:
position = -103
score = 4.83388
sequence = AACAGAACATCTGTTCTTAG

Site:
position = -74
score = 5.44237
sequence = AAACGAACAAATGTTTGTTC

Gene: SH1568: SOS regulatory LexA protein
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -131
score = 4.74544
sequence = CCTAGAACGTTTGTTTGTAT

Site:
position = -102
score = 4.93502
sequence = ATCAGAACATTTGTTCTATG

Site:
position = -73
score = 5.52377
sequence = AAACGAACAAACGTTTGTAA

Gene: SSP1418: SOS regulatory LexA protein
*
Macrococcus caseolyticus JCSC5402

Site:
position = -77
score = 5.66199
sequence = ATACGAACAAATGTTTGTTA

Site:
position = -135
score = 4.88366
sequence = CCTAGAACATTTGTTTGTAT

Gene: MCCL_0995: SOS regulatory LexA protein
SOS regulatory LexA protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD