Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog BDP_2071 - Bifidobacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode:
Biological process: Carbohydrate metabolism
Effector:
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bifidobacterium longum subsp. infantis ATCC 15697
Bifidobacterium adolescentis ATCC 15703
Bifidobacterium angulatum DSM 20098
Bifidobacterium animalis subsp. lactis AD011
Bifidobacterium bifidum NCIMB 41171
Bifidobacterium breve DSM 20213
Bifidobacterium dentium Bd1 5 2
Bifidobacterium gallicum DSM 20093
Bifidobacterium longum NCC2705 5 2
Gardnerella vaginalis 409-05
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
BDP_2071
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
*
Bifidobacterium dentium Bd1

Site:
position = -173
score = 5.99967
sequence = TTGCGTTCAGTTGTCAAACTCAA

Gene: BDP_2071: Transcriptional regulator, ROK family
 
Bifidobacterium gallicum DSM 20093
*
Bifidobacterium longum NCC2705

Site:
position = -161
score = 5.93346
sequence = TTGAGTTAAGTTGTCAAACTCAA

Gene: BL1693: Transcriptional regulator, ROK family
 
Gardnerella vaginalis 409-05
Transcriptional regulator, ROK family
BDP_2072
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011

Gene: BLA_0052: ABC transporter, ATP-binding protein
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1

Gene: BDP_2072: ABC transporter, ATP-binding protein
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705

Gene: BL1692: ABC transporter, ATP-binding protein
 
Gardnerella vaginalis 409-05
ABC transporter, ATP-binding protein
 
CRON 2.
BDP_2070
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
*
Bifidobacterium dentium Bd1

Site:
position = -106
score = 5.99967
sequence = TTGAGTTTGACAACTGAACGCAA

Gene: BDP_2070: ABC transporter, sugar-binding component
 
Bifidobacterium gallicum DSM 20093
*
Bifidobacterium longum NCC2705

Site:
position = -113
score = 5.93346
sequence = TTGAGTTTGACAACTTAACTCAA

Gene: BL1694: ABC transporter, sugar-binding component
 
Gardnerella vaginalis 409-05
ABC transporter, sugar-binding component
BDP_2069
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1

Gene: BDP_2069: ABC transporter, ATP-binding component
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705

Gene: BL1695: ABC transporter, ATP-binding component
 
Gardnerella vaginalis 409-05
ABC transporter, ATP-binding component
BDP_2068
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1

Gene: BDP_2068: ABC transporter, permease component
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705

Gene: BL1696: ABC transporter, permease component
 
Gardnerella vaginalis 409-05
ABC transporter, permease component
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD