Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NanR - Bifidobacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Sialic acid utilization
Effector: Sialic acid
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 11 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bifidobacterium longum subsp. infantis ATCC 15697 9 3
Bifidobacterium adolescentis ATCC 15703
Bifidobacterium angulatum DSM 20098
Bifidobacterium animalis subsp. lactis AD011
Bifidobacterium bifidum NCIMB 41171
Bifidobacterium breve DSM 20213 8 2
Bifidobacterium dentium Bd1
Bifidobacterium gallicum DSM 20093 6 2
Bifidobacterium longum NCC2705
Gardnerella vaginalis 409-05
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
nanH
*
Bifidobacterium longum subsp. infantis ATCC 15697

Site:
position = -200
score = 6.50645
sequence = ATAAGACGTCTGACGTCTTAT

Site:
position = -102
score = 5.00828
sequence = ATCAGACGTCTGATGTTTCCC

Gene: Blon_0646: Sialidase (EC 3.2.1.18)
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213

Gene: BIFBRE_01961: Sialidase (EC 3.2.1.18)
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
Sialidase (EC 3.2.1.18)
 
CRON 2.
SSF51658
*
Bifidobacterium longum subsp. infantis ATCC 15697

Site:
position = -73
score = 5.23675
sequence = GATATACATCAGATGTCTGAT

Site:
position = -66
score = 5.42942
sequence = ATCAGATGTCTGATGTATAAT

Gene: Blon_0643: Xylose isomerase-like, TIM barrel domain
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
*
Bifidobacterium breve DSM 20213

Site:
position = -36
score = 6.25217
sequence = ATTGGACATCAGACGTCTGAT

Gene: BIFBRE_01949: Xylose isomerase-like, TIM barrel domain
 
Bifidobacterium dentium Bd1
*
Bifidobacterium gallicum DSM 20093

Site:
position = -220
score = 6.07793
sequence = GTAAGACATCAGATGTCTGAT

Gene: BIFGAL_00397: Xylose isomerase-like, TIM barrel domain
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
Xylose isomerase-like, TIM barrel domain
nanK
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_0644: N-acetylmannosamine kinase (EC 2.7.1.60)
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213

Gene: BIFBRE_01950: N-acetylmannosamine kinase (EC 2.7.1.60)
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
N-acetylmannosamine kinase (EC 2.7.1.60)
nanE
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_0645: N-acetylmannosamine-6-phosphate 2-epimerase (EC 5.1.3.9)
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
N-acetylmannosamine-6-phosphate 2-epimerase (EC 5.1.3.9)
 
CRON 3.
nanB
*
Bifidobacterium longum subsp. infantis ATCC 15697

Site:
position = -250
score = 4.89816
sequence = GGGAAACATCAGACGTCTGAT

Site:
position = -152
score = 6.58557
sequence = ATAAGACGTCAGACGTCTTAT

Gene: Blon_0647: Predicted sialic acid ABC transporter, solute binding component
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
*
Bifidobacterium breve DSM 20213

Site:
position = -149
score = 5.51163
sequence = ATAAGTTGTCTGATGTCTTAA

Site:
position = -42
score = 5.83195
sequence = ATCAGACATCAGATGTCATAT

Gene: BIFBRE_01954: Predicted sialic acid ABC transporter, solute binding component
 
Bifidobacterium dentium Bd1
*
Bifidobacterium gallicum DSM 20093

Site:
position = -12
score = 6.18943
sequence = ATCAGACATCTGATGTCTTAC

Gene: BIFGAL_00396: Predicted sialic acid ABC transporter, solute binding component
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
Predicted sialic acid ABC transporter, solute binding component
nanC
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_0648: Predicted sialic acid ABC transporter, permease component
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213

Gene: BIFBRE_01955: Predicted sialic acid ABC transporter, permease component
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093

Gene: BIFGAL_00395: Predicted sialic acid ABC transporter, permease component
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
Predicted sialic acid ABC transporter, permease component
nanD
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_0649: Predicted sialic acid ABC transporter, permease component and ATP-binding component
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213

Gene: BIFBRE_01956: Predicted sialic acid ABC transporter, permease component and ATP-binding component
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093

Gene: BIFGAL_00394: Predicted sialic acid ABC transporter, permease component and ATP-binding component
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
Predicted sialic acid ABC transporter, permease component and ATP-binding component
nanF
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_0650: Predicted sialic acid ABC transporter, ATP binding component
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213

Gene: BIFBRE_01957: Predicted sialic acid ABC transporter, ATP binding component
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093

Gene: BIFGAL_00393: Predicted sialic acid ABC transporter, ATP binding component
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
Predicted sialic acid ABC transporter, ATP binding component
nanA
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_0651: N-acetylneuraminate lyase (EC 2.5.1.56)
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213

Gene: BIFBRE_01958: N-acetylneuraminate lyase (EC 2.5.1.56)
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093

Gene: BIFGAL_00392: N-acetylneuraminate lyase (EC 2.5.1.56)
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
N-acetylneuraminate lyase (EC 2.5.1.56)
nagB2
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213

Gene: BIFBRE_01959: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD