Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog GarR - Bacillales

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Galactarate utilization
Effector: Galactarate
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Anoxybacillus flavithermus WK1
Bacillus amyloliquefaciens FZB42
Bacillus cereus ATCC 14579
Bacillus clausii KSM-K16 7 1
Bacillus halodurans C-125
Bacillus licheniformis DSM 13
Bacillus pumilus SAFR-032
Bacillus subtilis subsp. subtilis str. 168
Geobacillus kaustophilus HTA426
Oceanobacillus iheyensis HTE831 9 2
Paenibacillus sp. JDR-2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
OB2846
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
*
Oceanobacillus iheyensis HTE831

Site:
position = -41
score = 6.65147
sequence = GTTGATATATCAGATATCAAC

Gene: OB2846: (R)-2-hydroxyacid dehydrogenase, similar to L-sulfolactate dehydrogenase (EC 1.1.1.272)
 
Paenibacillus sp. JDR-2
(R)-2-hydroxyacid dehydrogenase, similar to L-sulfolactate dehydrogenase (EC 1.1.1.272)
kdgD
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16

Gene: ABC3015: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831

Gene: OB2845: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
 
Paenibacillus sp. JDR-2
5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
OB2844
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831

Gene: OB2844: D-3-phosphoglycerate dehydrogenase (EC 1.1.1.95)
 
Paenibacillus sp. JDR-2
D-3-phosphoglycerate dehydrogenase (EC 1.1.1.95)
garD2
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16

Gene: ABC3013: D-galactarate dehydratase (EC 4.2.1.42), alternative enzyme
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831

Gene: OB2843: D-galactarate dehydratase (EC 4.2.1.42), alternative enzyme
 
Paenibacillus sp. JDR-2
D-galactarate dehydratase (EC 4.2.1.42), alternative enzyme
ycbG
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831

Gene: OB2842: Predicted 5-dehydro-4-deoxyglucarate regulator YcbG
 
Paenibacillus sp. JDR-2
Predicted 5-dehydro-4-deoxyglucarate regulator YcbG
ycbC
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831

Gene: OB2841: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
 
Paenibacillus sp. JDR-2
5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
kgsD
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16

Gene: ABC3014: Ketoglutarate semialdehyde dehydrogenase (EC 1.2.1.26) # in D-glucarate/D-galactarate catabolism
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831

Gene: OB2840: Ketoglutarate semialdehyde dehydrogenase (EC 1.2.1.26) # in D-glucarate/D-galactarate catabolism
 
Paenibacillus sp. JDR-2
Ketoglutarate semialdehyde dehydrogenase (EC 1.2.1.26) # in D-glucarate/D-galactarate catabolism
garR
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
*
Bacillus clausii KSM-K16

Site:
position = -42
score = 6.27438
sequence = TGTGATATATCAGATTTCATA

Gene: ABC3016: Predicted transcriptional regulator for galactarate utilization, GntR family
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831

Gene: OB2847: Predicted transcriptional regulator for galactarate utilization, GntR family
 
Paenibacillus sp. JDR-2
Predicted transcriptional regulator for galactarate utilization, GntR family
tctC_Gar
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16

Gene: ABC3012: Tripartite tricarboxylate transporter family receptor, putative transporter for galactarate
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Tripartite tricarboxylate transporter family receptor, putative transporter for galactarate
tctB_Gar
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16

Gene: ABC3011: Tripartite tricarboxylate transporter family small permease component, putative transporter for galactarate
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Tripartite tricarboxylate transporter family small permease component, putative transporter for galactarate
tctA_Gar
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16

Gene: ABC3010: Tripartite tricarboxylate transporter family large permease component, putative transporter for galactarate
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Tripartite tricarboxylate transporter family large permease component, putative transporter for galactarate
OB2848
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
*
Oceanobacillus iheyensis HTE831

Site:
position = -48
score = 6.56782
sequence = TCTGATATATCATATACCAAA

Gene: OB2848: Glyoxylate reductase (EC 1.1.1.79) / Glyoxylate reductase (EC 1.1.1.26) / Hydroxypyruvate reductase (EC 1.1.1.81); 2-ketoaldonate reductase, broad specificity (EC 1.1.1.215) (EC 1.1.1.-)
 
Paenibacillus sp. JDR-2
Glyoxylate reductase (EC 1.1.1.79) / Glyoxylate reductase (EC 1.1.1.26) / Hydroxypyruvate reductase (EC 1.1.1.81); 2-ketoaldonate reductase, broad specificity (EC 1.1.1.215) (EC 1.1.1.-)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD