Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog IcaR - Staphylococcaceae

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Intercellular adhesion
Effector:
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Staphylococcus aureus subsp. aureus N315 5 2
Staphylococcus capitis SK14 5 2
Staphylococcus epidermidis ATCC 12228
Staphylococcus carnosus subsp. carnosus TM300
Staphylococcus haemolyticus JCSC1435
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
Macrococcus caseolyticus JCSC5402
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
icaR
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -156
score = 7.23972
sequence = ACCTACCTTTCGTTAGTTAGGT

Gene: SA2458: icaADBC operon transcriptional regulator
*
Staphylococcus capitis SK14

Site:
position = -159
score = 7.23972
sequence = ACCTACCTTTCGTTAGTTAGGT

Gene: STACA0001_0089: icaADBC operon transcriptional regulator
 
Staphylococcus epidermidis ATCC 12228
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_0084: icaADBC operon transcriptional regulator
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP0115: icaADBC operon transcriptional regulator
 
Macrococcus caseolyticus JCSC5402
icaADBC operon transcriptional regulator
 
CRON 2.
icaA
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -29
score = 7.23972
sequence = ACCTAACTAACGAAAGGTAGGT

Gene: SA2459: polysaccharide intercellular adhesin biosynthesis N-glycosyltransferase (EC 2.4.-.-)
*
Staphylococcus capitis SK14

Site:
position = -29
score = 7.23972
sequence = ACCTAACTAACGAAAGGTAGGT

Gene: STACA0001_0088: polysaccharide intercellular adhesin biosynthesis N-glycosyltransferase (EC 2.4.-.-)
 
Staphylococcus epidermidis ATCC 12228
 
Staphylococcus carnosus subsp. carnosus TM300
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
 
Macrococcus caseolyticus JCSC5402
polysaccharide intercellular adhesin biosynthesis N-glycosyltransferase (EC 2.4.-.-)
icaD
 
Staphylococcus aureus subsp. aureus N315

Gene: SA2460: polysaccharide intercellular adhesin biosynthesis protein
 
Staphylococcus capitis SK14

Gene: STACA0001_0087: polysaccharide intercellular adhesin biosynthesis protein
 
Staphylococcus epidermidis ATCC 12228
 
Staphylococcus carnosus subsp. carnosus TM300
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
 
Macrococcus caseolyticus JCSC5402
polysaccharide intercellular adhesin biosynthesis protein
icaB
 
Staphylococcus aureus subsp. aureus N315

Gene: SA2461: polysaccharide intercellular adhesin biosynthesis deacetylase (EC 3.-.-.-)
 
Staphylococcus capitis SK14

Gene: STACA0001_0086: polysaccharide intercellular adhesin biosynthesis deacetylase (EC 3.-.-.-)
 
Staphylococcus epidermidis ATCC 12228
 
Staphylococcus carnosus subsp. carnosus TM300
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
 
Macrococcus caseolyticus JCSC5402
polysaccharide intercellular adhesin biosynthesis deacetylase (EC 3.-.-.-)
icaC
 
Staphylococcus aureus subsp. aureus N315

Gene: SA2462: polysaccharide intercellular adhesin biosynthesis protein
 
Staphylococcus capitis SK14

Gene: STACA0001_0085: polysaccharide intercellular adhesin biosynthesis protein
 
Staphylococcus epidermidis ATCC 12228
 
Staphylococcus carnosus subsp. carnosus TM300
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
 
Macrococcus caseolyticus JCSC5402
polysaccharide intercellular adhesin biosynthesis protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD