Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog BLA_0357 - Bifidobacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode:
Biological process: Galactooligosaccharide utilization
Effector:
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 15 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bifidobacterium longum subsp. infantis ATCC 15697 2 1
Bifidobacterium adolescentis ATCC 15703 2 1
Bifidobacterium angulatum DSM 20098 2 2
Bifidobacterium animalis subsp. lactis AD011 2 1
Bifidobacterium bifidum NCIMB 41171 2 1
Bifidobacterium breve DSM 20213 2 2
Bifidobacterium dentium Bd1 2 2
Bifidobacterium gallicum DSM 20093 2 1
Bifidobacterium longum NCC2705 2 1
Gardnerella vaginalis 409-05
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
BLA_0357
*
Bifidobacterium longum subsp. infantis ATCC 15697

Site:
position = -140
score = 5.76428
sequence = TTCTAGAAAATTGATTTAAAAAA

Site:
position = -182
score = 6.32197
sequence = TTTTTTAAAGTAAGTTTTCAAAA

Gene: Blon_2242: Transcriptional regulator, ROK family
 
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_0315: Transcriptional regulator, ROK family
*
Bifidobacterium angulatum DSM 20098

Site:
position = -91
score = 5.95093
sequence = TTTTCGAAAGTAGTTTTGTAAAA

Gene: BIFANG_00714: Transcriptional regulator, ROK family
*
Bifidobacterium animalis subsp. lactis AD011

Site:
position = -104
score = 6.45597
sequence = TTTTGAAAATCAGCTTTGCAAAA

Gene: BLA_0357: Transcriptional regulator, ROK family
*
Bifidobacterium bifidum NCIMB 41171

Site:
position = -117
score = 5.02669
sequence = TTATATAAAGTATGTTTATAAAA

Site:
position = -75
score = 5.96945
sequence = TTTTATAAAATTATTTATTAAAA

Gene: BbifN4_010100007732: Transcriptional regulator, ROK family
*
Bifidobacterium breve DSM 20213

Site:
position = -75
score = 5.23574
sequence = ATTTCAAAAAGTCTTTTGCTAAA

Gene: BIFBRE_00264: Transcriptional regulator, ROK family
*
Bifidobacterium dentium Bd1

Site:
position = -72
score = 5.11469
sequence = TTCTTGAAAACACTTTTCTAAAG

Gene: BDP_0425: Transcriptional regulator, ROK family
*
Bifidobacterium gallicum DSM 20093

Site:
position = -395
score = 4.99717
sequence = TTTTGCAAAGTGAGTTGTGAAAA

Gene: BIFGAL_00794: Transcriptional regulator, ROK family
*
Bifidobacterium longum NCC2705

Site:
position = -140
score = 5.52836
sequence = TTCTAGAAAGTTGGTTTAAAAAA

Site:
position = -182
score = 6.32197
sequence = TTTTTTAAAGTAAGTTTTCAAAA

Gene: BL1574: Transcriptional regulator, ROK family
 
Gardnerella vaginalis 409-05
Transcriptional regulator, ROK family
glgX
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_2243: Glycogen debranching enzyme (EC 3.2.1.-)
*2
Bifidobacterium adolescentis ATCC 15703

Site:
position = -219
score = 6.23742
sequence = TTTTGCAAATCTCTTTTCATAAA

Gene: BAD_0312: Glycogen debranching enzyme (EC 3.2.1.-)

Gene: BAD_0311: Glycogen debranching enzyme (EC 3.2.1.-)
*
Bifidobacterium angulatum DSM 20098

Site:
position = -76
score = 6.23742
sequence = TTTTGCAAATCTGTTTTCTTAAA

Gene: BIFANG_00707: Glycogen debranching enzyme (EC 3.2.1.-)
 
Bifidobacterium animalis subsp. lactis AD011

Gene: BLA_0356: Glycogen debranching enzyme (EC 3.2.1.-)
 
Bifidobacterium bifidum NCIMB 41171

Gene: BbifN4_010100007727: Glycogen debranching enzyme (EC 3.2.1.-)
*
Bifidobacterium breve DSM 20213

Site:
position = -215
score = 6.31111
sequence = TTTTGCAAATTTCTTTTCATAAA

Gene: BIFBRE_00259: Glycogen debranching enzyme (EC 3.2.1.-)
*
Bifidobacterium dentium Bd1

Site:
position = -185
score = 6.31111
sequence = TTTTGCAAATTTCTTTTCATAAA

Gene: BDP_0421: Glycogen debranching enzyme (EC 3.2.1.-)
 
Bifidobacterium gallicum DSM 20093

Gene: BIFGAL_00793: Glycogen debranching enzyme (EC 3.2.1.-)
 
Bifidobacterium longum NCC2705

Gene: BL1573: Glycogen debranching enzyme (EC 3.2.1.-)
 
Gardnerella vaginalis 409-05
Glycogen debranching enzyme (EC 3.2.1.-)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD