Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Crp - Bifidobacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode:
Biological process: Tricarboxylic acid cycle; Energy metabolism
Effector:
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 52 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bifidobacterium longum subsp. infantis ATCC 15697 13 9
Bifidobacterium adolescentis ATCC 15703 4 3
Bifidobacterium angulatum DSM 20098 3 2
Bifidobacterium animalis subsp. lactis AD011 5 3
Bifidobacterium bifidum NCIMB 41171 8 7
Bifidobacterium breve DSM 20213 13 9
Bifidobacterium dentium Bd1 4 3
Bifidobacterium gallicum DSM 20093 4 3
Bifidobacterium longum NCC2705 12 8
Gardnerella vaginalis 409-05 7 4
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
nrdH
*
Bifidobacterium longum subsp. infantis ATCC 15697

Site:
position = -209
score = 5.07558
sequence = AAATGTGAACAATGCCACATGT

Gene: Blon_2480: Glutaredoxin-like protein NrdH, required for reduction of Ribonucleotide reductase class Ib
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171

Gene: BbifN4_010100007467: Glutaredoxin-like protein NrdH, required for reduction of Ribonucleotide reductase class Ib
*
Bifidobacterium breve DSM 20213

Site:
position = -162
score = 5.19342
sequence = AAATGTGAACAATGCCACATAT

Gene: BIFBRE_00660: Glutaredoxin-like protein NrdH, required for reduction of Ribonucleotide reductase class Ib
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
*
Bifidobacterium longum NCC2705

Site:
position = -162
score = 5.07558
sequence = AAATGTGAACAATGCCACATGT

Gene: BL0668: Glutaredoxin-like protein NrdH, required for reduction of Ribonucleotide reductase class Ib
*
Gardnerella vaginalis 409-05

Site:
position = -232
score = 5.01836
sequence = TTTTGTGAAATAAATTACATTT

Gene: HMPREF0424_0179: Glutaredoxin-like protein NrdH, required for reduction of Ribonucleotide reductase class Ib
Glutaredoxin-like protein NrdH, required for reduction of Ribonucleotide reductase class Ib
nrdI
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_2479: Ribonucleotide reduction protein NrdI
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011

Gene: BLA_0312: Ribonucleotide reduction protein NrdI
 
Bifidobacterium bifidum NCIMB 41171

Gene: BbifN4_010100007462: Ribonucleotide reduction protein NrdI
 
Bifidobacterium breve DSM 20213

Gene: BIFBRE_00659: Ribonucleotide reduction protein NrdI
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705

Gene: BL0669: Ribonucleotide reduction protein NrdI
 
Gardnerella vaginalis 409-05

Gene: HMPREF0424_0178: Ribonucleotide reduction protein NrdI
Ribonucleotide reduction protein NrdI
nrdE
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_2478: Ribonucleotide reductase of class Ib (aerobic), alpha subunit (EC 1.17.4.1)
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011

Gene: BLA_0311: Ribonucleotide reductase of class Ib (aerobic), alpha subunit (EC 1.17.4.1)
 
Bifidobacterium bifidum NCIMB 41171

Gene: BbifN4_010100007457: Ribonucleotide reductase of class Ib (aerobic), alpha subunit (EC 1.17.4.1)
 
Bifidobacterium breve DSM 20213

Gene: BIFBRE_00658: Ribonucleotide reductase of class Ib (aerobic), alpha subunit (EC 1.17.4.1)
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705

Gene: BL0670: Ribonucleotide reductase of class Ib (aerobic), alpha subunit (EC 1.17.4.1)
 
Gardnerella vaginalis 409-05

Gene: HMPREF0424_0177: Ribonucleotide reductase of class Ib (aerobic), alpha subunit (EC 1.17.4.1)
Ribonucleotide reductase of class Ib (aerobic), alpha subunit (EC 1.17.4.1)
 
CRON 2.
pta
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_1730: Phosphate acetyltransferase (EC 2.3.1.8)
 
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_0688: Phosphate acetyltransferase (EC 2.3.1.8)
 
Bifidobacterium angulatum DSM 20098

Gene: BIFANG_01170: Phosphate acetyltransferase (EC 2.3.1.8)
*
Bifidobacterium animalis subsp. lactis AD011

Site:
position = -133
score = 5.20435
sequence = GAATGTGACCTGCGTCACATTC

Gene: BLA_1484: Phosphate acetyltransferase (EC 2.3.1.8)
 
Bifidobacterium bifidum NCIMB 41171

Gene: BbifN4_010100003454: Phosphate acetyltransferase (EC 2.3.1.8)
 
Bifidobacterium breve DSM 20213

Gene: BIFBRE_01069: Phosphate acetyltransferase (EC 2.3.1.8)
 
Bifidobacterium dentium Bd1

Gene: BDP_1007: Phosphate acetyltransferase (EC 2.3.1.8)
*
Bifidobacterium gallicum DSM 20093

Site:
position = -283
score = 5.87403
sequence = GATTGTGACACAGGTCACGTTC

Gene: BIFGAL_01466: Phosphate acetyltransferase (EC 2.3.1.8)
 
Bifidobacterium longum NCC2705

Gene: BL0968: Phosphate acetyltransferase (EC 2.3.1.8)
 
Gardnerella vaginalis 409-05

Gene: HMPREF0424_0624: Phosphate acetyltransferase (EC 2.3.1.8)
Phosphate acetyltransferase (EC 2.3.1.8)
ackA
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_1731: Acetate kinase (EC 2.7.2.1)
 
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_0689: Acetate kinase (EC 2.7.2.1)
 
Bifidobacterium angulatum DSM 20098

Gene: BIFANG_01171: Acetate kinase (EC 2.7.2.1)
 
Bifidobacterium animalis subsp. lactis AD011

Gene: BLA_1485: Acetate kinase (EC 2.7.2.1)
 
Bifidobacterium bifidum NCIMB 41171

Gene: BbifN4_010100003449: Acetate kinase (EC 2.7.2.1)
 
Bifidobacterium breve DSM 20213

Gene: BIFBRE_01068: Acetate kinase (EC 2.7.2.1)
 
Bifidobacterium dentium Bd1

Gene: BDP_1008: Acetate kinase (EC 2.7.2.1)
 
Bifidobacterium gallicum DSM 20093

Gene: BIFGAL_01465: Acetate kinase (EC 2.7.2.1)
 
Bifidobacterium longum NCC2705

Gene: BL0969: Acetate kinase (EC 2.7.2.1)
 
Gardnerella vaginalis 409-05

Gene: HMPREF0424_0623: Acetate kinase (EC 2.7.2.1)
Acetate kinase (EC 2.7.2.1)
 
CRON 3.
Blon_0037
*
Bifidobacterium longum subsp. infantis ATCC 15697

Site:
position = -290
score = 4.74576
sequence = CGATGTGAGAAAGCTCACGGTC

Gene: Blon_0037: Major facilitator superfamily, general substrate transporter
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
*
Bifidobacterium bifidum NCIMB 41171

Site:
position = -242
score = 4.67478
sequence = CGATGTGAATAAGTTCACGGAT

Gene: BbifN4_010100009176: Major facilitator superfamily, general substrate transporter
*
Bifidobacterium breve DSM 20213

Site:
position = -208
score = 4.61846
sequence = AACCGTGACGATACTCACATGA

Gene: BIFBRE_01254: Major facilitator superfamily, general substrate transporter
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
*
Bifidobacterium longum NCC2705

Site:
position = -290
score = 4.442
sequence = CGATGTGAGAAAGCTCATAGCT

Gene: BL0613: Major facilitator superfamily, general substrate transporter
 
Gardnerella vaginalis 409-05
Major facilitator superfamily, general substrate transporter
 
CRON 4.
nox
*
Bifidobacterium longum subsp. infantis ATCC 15697

Site:
position = -105
score = 4.8426
sequence = TAACGTGATCTTCCTCACATTT

Gene: Blon_2322: Uncharacterized NAD(FAD)-dependent dehydrogenase
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011

Gene: BLA_0232: Uncharacterized NAD(FAD)-dependent dehydrogenase
*
Bifidobacterium bifidum NCIMB 41171

Site:
position = -131
score = 4.43363
sequence = CATCGTGATGTTCGTCACATCC

Gene: BbifN4_010100008701: Uncharacterized NAD(FAD)-dependent dehydrogenase
*
Bifidobacterium breve DSM 20213

Site:
position = -66
score = 4.7275
sequence = AAACGTGACCTTCCTCACAGCT

Gene: BIFBRE_00121: Uncharacterized NAD(FAD)-dependent dehydrogenase
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093

Gene: BIFGAL_00071: Uncharacterized NAD(FAD)-dependent dehydrogenase
*
Bifidobacterium longum NCC2705

Site:
position = -105
score = 4.8426
sequence = TAACGTGATCTTCCTCACATTT

Gene: BL1266: Uncharacterized NAD(FAD)-dependent dehydrogenase
 
Gardnerella vaginalis 409-05
Uncharacterized NAD(FAD)-dependent dehydrogenase
 
CRON 5.
aldB
*
Bifidobacterium longum subsp. infantis ATCC 15697

Site:
position = -78
score = 4.91021
sequence = TATAGTGGTATAGCTCACGTTG

Gene: Blon_2239: Alpha-acetolactate decarboxylase (EC 4.1.1.5)
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
*
Bifidobacterium bifidum NCIMB 41171

Site:
position = 5
score = 4.91802
sequence = GTTCGTGAGGCAGGTCACAGCG

Gene: BbifN4_010100007742: Alpha-acetolactate decarboxylase (EC 4.1.1.5)
*
Bifidobacterium breve DSM 20213

Site:
position = -76
score = 4.28835
sequence = ACACGTGTCATAAATCACGCAC

Site:
position = -38
score = 4.66983
sequence = GATTGTGACGTACAGCACTGGG

Gene: BIFBRE_00271: Alpha-acetolactate decarboxylase (EC 4.1.1.5)
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
Alpha-acetolactate decarboxylase (EC 4.1.1.5)
 
CRON 6.
ilvC2
*
Bifidobacterium longum subsp. infantis ATCC 15697

Site:
position = -170
score = 4.6843
sequence = TGGCGTGAAATAGCTCACGTTG

Gene: Blon_0136: Ketol-acid reductoisomerase (EC 1.1.1.86)
 2
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_0082: Ketol-acid reductoisomerase (EC 1.1.1.86)

Gene: BAD_0081: Ketol-acid reductoisomerase (EC 1.1.1.86)
 
Bifidobacterium angulatum DSM 20098

Gene: BIFANG_00307: Ketol-acid reductoisomerase (EC 1.1.1.86)
 
Bifidobacterium animalis subsp. lactis AD011

Gene: BLA_0138: Ketol-acid reductoisomerase (EC 1.1.1.86)
*
Bifidobacterium bifidum NCIMB 41171

Site:
position = -218
score = 4.69487
sequence = AATAGTGAGATGGTTCACGTTG

Gene: BbifN4_010100000325: Ketol-acid reductoisomerase (EC 1.1.1.86)
*
Bifidobacterium breve DSM 20213

Site:
position = -171
score = 5.47619
sequence = AATAGTGACCTAGCTCACGTTG

Gene: BIFBRE_01899: Ketol-acid reductoisomerase (EC 1.1.1.86)
 2
Bifidobacterium dentium Bd1

Gene: BDP_0118: Ketol-acid reductoisomerase (EC 1.1.1.86)

Gene: BDP_0119: Ketol-acid reductoisomerase (EC 1.1.1.86)
 
Bifidobacterium gallicum DSM 20093

Gene: BIFGAL_02007: Ketol-acid reductoisomerase (EC 1.1.1.86)
*
Bifidobacterium longum NCC2705

Site:
position = -163
score = 5.47619
sequence = AATAGTGACCTAGCTCACGTTG

Gene: BL0530: Ketol-acid reductoisomerase (EC 1.1.1.86)
 
Gardnerella vaginalis 409-05
Ketol-acid reductoisomerase (EC 1.1.1.86)
 
CRON 7.
ispD
*
Bifidobacterium longum subsp. infantis ATCC 15697

Site:
position = -50
score = 4.84292
sequence = AGATGTGATGCAGTTCACGGAC

Gene: Blon_0353: 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase (EC 2.7.7.60)
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011

Gene: BLA_0317: 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase (EC 2.7.7.60)
 
Bifidobacterium bifidum NCIMB 41171

Gene: BbifN4_010100007497: 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase (EC 2.7.7.60)
*
Bifidobacterium breve DSM 20213

Site:
position = -50
score = 4.76362
sequence = AGCTGTGAGGCAGGTCACGAAC

Gene: BIFBRE_00201: 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase (EC 2.7.7.60)
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093

Gene: BIFGAL_00734: 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase (EC 2.7.7.60)
*
Bifidobacterium longum NCC2705

Site:
position = -50
score = 4.84292
sequence = AGATGTGATGCAGTTCACGGAC

Gene: BL0324: 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase (EC 2.7.7.60)
 
Gardnerella vaginalis 409-05
2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase (EC 2.7.7.60)
pcp
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_0354: Pyrrolidone-carboxylate peptidase (EC 3.4.19.3)
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011

Gene: BLA_0318: Pyrrolidone-carboxylate peptidase (EC 3.4.19.3)
 
Bifidobacterium bifidum NCIMB 41171

Gene: BbifN4_010100007502: Pyrrolidone-carboxylate peptidase (EC 3.4.19.3)
 
Bifidobacterium breve DSM 20213

Gene: BIFBRE_00202: Pyrrolidone-carboxylate peptidase (EC 3.4.19.3)
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093

Gene: BIFGAL_00735: Pyrrolidone-carboxylate peptidase (EC 3.4.19.3)
 
Bifidobacterium longum NCC2705

Gene: BL0323: Pyrrolidone-carboxylate peptidase (EC 3.4.19.3)
 
Gardnerella vaginalis 409-05
Pyrrolidone-carboxylate peptidase (EC 3.4.19.3)
 
CRON 8.
ldh
*
Bifidobacterium longum subsp. infantis ATCC 15697

Site:
position = -183
score = 5.52814
sequence = TAACGTGATAAACATCACAGTT

Gene: Blon_0840: L-lactate dehydrogenase (EC 1.1.1.27)
*
Bifidobacterium adolescentis ATCC 15703

Site:
position = -4
score = 5.43909
sequence = AGCTGTGACGAAAATCACTTTT

Gene: BAD_1117: L-lactate dehydrogenase (EC 1.1.1.27)
 
Bifidobacterium angulatum DSM 20098

Gene: BIFANG_00987: L-lactate dehydrogenase (EC 1.1.1.27)
 
Bifidobacterium animalis subsp. lactis AD011

Gene: BLA_0792: L-lactate dehydrogenase (EC 1.1.1.27)
*
Bifidobacterium bifidum NCIMB 41171

Site:
position = -145
score = 5.78575
sequence = CAATGTGACGCAAATCACCTTG

Gene: BbifN4_010100002254: L-lactate dehydrogenase (EC 1.1.1.27)
*
Bifidobacterium breve DSM 20213

Site:
position = -183
score = 5.80495
sequence = TAACGTGACGAAAATCACATAA

Gene: BIFBRE_01807: L-lactate dehydrogenase (EC 1.1.1.27)
*
Bifidobacterium dentium Bd1

Site:
position = -143
score = 5.49723
sequence = AAGTGTGGCGCAAATCACGTTT

Gene: BDP_1558: L-lactate dehydrogenase (EC 1.1.1.27)
 
Bifidobacterium gallicum DSM 20093

Gene: BIFGAL_00305: L-lactate dehydrogenase (EC 1.1.1.27)
*
Bifidobacterium longum NCC2705

Site:
position = -183
score = 5.36499
sequence = TAACGTGATAAACATCACAGTA

Gene: BL1308: L-lactate dehydrogenase (EC 1.1.1.27)
 
Gardnerella vaginalis 409-05

Gene: HMPREF0424_0584: L-lactate dehydrogenase (EC 1.1.1.27)
L-lactate dehydrogenase (EC 1.1.1.27)
 
CRON 9.
pflB
*
Bifidobacterium longum subsp. infantis ATCC 15697

Site:
position = -81
score = 5.0646
sequence = CAATGTGAGATAGCTCACCCCC

Gene: Blon_1715: Pyruvate formate-lyase (EC 2.3.1.54)
*
Bifidobacterium adolescentis ATCC 15703

Site:
position = -126
score = 5.59541
sequence = GATTGTGATTTATGTCACTAAT

Gene: BAD_0992: Pyruvate formate-lyase (EC 2.3.1.54)
*
Bifidobacterium angulatum DSM 20098

Site:
position = -114
score = 5.86304
sequence = AAATGTGAGATAGCTCACTTCG

Gene: BIFANG_01531: Pyruvate formate-lyase (EC 2.3.1.54)
*
Bifidobacterium animalis subsp. lactis AD011

Site:
position = -123
score = 5.68162
sequence = AAATGTGACCAAGCTCACGCGT

Gene: BLA_0967: Pyruvate formate-lyase (EC 2.3.1.54)
*
Bifidobacterium bifidum NCIMB 41171

Site:
position = -108
score = 5.36758
sequence = GAATGTGAGATAAGTCACGCCG

Gene: BbifN4_010100005855: Pyruvate formate-lyase (EC 2.3.1.54)
*
Bifidobacterium breve DSM 20213

Site:
position = -113
score = 5.27563
sequence = GAATGTGAGATAGCTCACTCCC

Gene: BIFBRE_01106: Pyruvate formate-lyase (EC 2.3.1.54)
*
Bifidobacterium dentium Bd1

Site:
position = -126
score = 5.69287
sequence = ATATGTGAAATAAATCACTTTT

Gene: BDP_1376: Pyruvate formate-lyase (EC 2.3.1.54)
*
Bifidobacterium gallicum DSM 20093

Site:
position = -116
score = 5.84852
sequence = AAATGTGACCAAGGTCACGCTG

Gene: BIFGAL_01295: Pyruvate formate-lyase (EC 2.3.1.54)
*
Bifidobacterium longum NCC2705

Site:
position = -75
score = 5.21301
sequence = CAATGTGAGATAGCTCACTCCC

Gene: BL0951: Pyruvate formate-lyase (EC 2.3.1.54)
*
Gardnerella vaginalis 409-05

Site:
position = -119
score = 5.26928
sequence = AAATGTGATATATTTCACTAGA

Gene: HMPREF0424_0886: Pyruvate formate-lyase (EC 2.3.1.54)
Pyruvate formate-lyase (EC 2.3.1.54)
pflA
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_1714: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
 
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_0991: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
 
Bifidobacterium angulatum DSM 20098

Gene: BIFANG_01530: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
 
Bifidobacterium animalis subsp. lactis AD011

Gene: BLA_0968: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
 
Bifidobacterium bifidum NCIMB 41171

Gene: BbifN4_010100005850: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
 
Bifidobacterium breve DSM 20213

Gene: BIFBRE_01107: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
 
Bifidobacterium dentium Bd1

Gene: BDP_1375: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
 
Bifidobacterium gallicum DSM 20093

Gene: BIFGAL_01294: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
 
Bifidobacterium longum NCC2705

Gene: BL0950: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
 
Gardnerella vaginalis 409-05

Gene: HMPREF0424_0885: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
 
CRON 10.
adh
*
Bifidobacterium longum subsp. infantis ATCC 15697

Site:
position = -149
score = 6.41413
sequence = TATTGTGACTCAGGTCACATAT

Gene: Blon_2241: Alcohol dehydrogenase (EC 1.1.1.1); Acetaldehyde dehydrogenase (EC 1.2.1.10)
*
Bifidobacterium adolescentis ATCC 15703

Site:
position = -109
score = 5.3126
sequence = AAGTGTGTCCTAGGTCACAAAA

Gene: BAD_0319: Alcohol dehydrogenase (EC 1.1.1.1); Acetaldehyde dehydrogenase (EC 1.2.1.10)
*
Bifidobacterium angulatum DSM 20098

Site:
position = -129
score = 5.05822
sequence = TATTGTGGGGCAGGTCACAGGC

Gene: BIFANG_00716: Alcohol dehydrogenase (EC 1.1.1.1); Acetaldehyde dehydrogenase (EC 1.2.1.10)
*
Bifidobacterium animalis subsp. lactis AD011

Site:
position = -76
score = 5.81023
sequence = GATTGTGAGACAACTCACATCT

Gene: BLA_0358: Alcohol dehydrogenase (EC 1.1.1.1); Acetaldehyde dehydrogenase (EC 1.2.1.10)
*
Bifidobacterium bifidum NCIMB 41171

Site:
position = -110
score = 4.85238
sequence = GATTGTGGCGTAGGCCACAGAT

Gene: BbifN4_010100007737: Alcohol dehydrogenase (EC 1.1.1.1); Acetaldehyde dehydrogenase (EC 1.2.1.10)
*
Bifidobacterium breve DSM 20213

Site:
position = -126
score = 5.62001
sequence = TATTGTGATGCAGGTCACAGGC

Gene: BIFBRE_00269: Alcohol dehydrogenase (EC 1.1.1.1); Acetaldehyde dehydrogenase (EC 1.2.1.10)
*
Bifidobacterium dentium Bd1

Site:
position = -109
score = 5.92021
sequence = GATTGTGACTCAGGTCACAACG

Gene: BDP_0426: Alcohol dehydrogenase (EC 1.1.1.1); Acetaldehyde dehydrogenase (EC 1.2.1.10)
*
Bifidobacterium gallicum DSM 20093

Site:
position = -94
score = 5.29386
sequence = ATTAGTGAATCAGGTCACATTG

Gene: BIFGAL_00796: Alcohol dehydrogenase (EC 1.1.1.1); Acetaldehyde dehydrogenase (EC 1.2.1.10)
*
Bifidobacterium longum NCC2705

Site:
position = -149
score = 5.93812
sequence = TATTGTGCCTCAGGTCACATAT

Gene: BL1575: Alcohol dehydrogenase (EC 1.1.1.1); Acetaldehyde dehydrogenase (EC 1.2.1.10)
*
Gardnerella vaginalis 409-05

Site:
position = -96
score = 5.77594
sequence = AATTGTGACTTGTATCACATAT

Gene: HMPREF0424_0254: Alcohol dehydrogenase (EC 1.1.1.1); Acetaldehyde dehydrogenase (EC 1.2.1.10)
Alcohol dehydrogenase (EC 1.1.1.1); Acetaldehyde dehydrogenase (EC 1.2.1.10)
 
CRON 11.
gnd
 2
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_0666: 6-phosphogluconate dehydrogenase, decarboxylating (EC 1.1.1.44)

Gene: Blon_0207: 6-phosphogluconate dehydrogenase, decarboxylating (EC 1.1.1.44)
 
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_0628: 6-phosphogluconate dehydrogenase, decarboxylating (EC 1.1.1.44)
 
Bifidobacterium angulatum DSM 20098

Gene: BIFANG_01254: 6-phosphogluconate dehydrogenase, decarboxylating (EC 1.1.1.44)
 
Bifidobacterium animalis subsp. lactis AD011

Gene: BLA_1007: 6-phosphogluconate dehydrogenase, decarboxylating (EC 1.1.1.44)
 
Bifidobacterium bifidum NCIMB 41171

Gene: BbifN4_010100008062: 6-phosphogluconate dehydrogenase, decarboxylating (EC 1.1.1.44)
 
Bifidobacterium breve DSM 20213

Gene: BIFBRE_02011: 6-phosphogluconate dehydrogenase, decarboxylating (EC 1.1.1.44)
 
Bifidobacterium dentium Bd1

Gene: BDP_0847: 6-phosphogluconate dehydrogenase, decarboxylating (EC 1.1.1.44)
 
Bifidobacterium gallicum DSM 20093

Gene: BIFGAL_01249: 6-phosphogluconate dehydrogenase, decarboxylating (EC 1.1.1.44)
 
Bifidobacterium longum NCC2705

Gene: BL0444: 6-phosphogluconate dehydrogenase, decarboxylating (EC 1.1.1.44)
*
Gardnerella vaginalis 409-05

Site:
position = -215
score = 4.81886
sequence = AAATGTAATTTATTTCACAAAA

Gene: HMPREF0424_0180: 6-phosphogluconate dehydrogenase, decarboxylating (EC 1.1.1.44)
6-phosphogluconate dehydrogenase, decarboxylating (EC 1.1.1.44)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD