Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog BBNG_01789 - Bifidobacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Carbohydrate metabolism
Effector:
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bifidobacterium longum subsp. infantis ATCC 15697
Bifidobacterium adolescentis ATCC 15703
Bifidobacterium angulatum DSM 20098
Bifidobacterium animalis subsp. lactis AD011
Bifidobacterium bifidum NCIMB 41171 3 2
Bifidobacterium breve DSM 20213
Bifidobacterium dentium Bd1
Bifidobacterium gallicum DSM 20093
Bifidobacterium longum NCC2705
Gardnerella vaginalis 409-05
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
BBNG_01789
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
*
Bifidobacterium bifidum NCIMB 41171

Site:
position = -260
score = 5.2552
sequence = CCTTGTAACCGTTTACATCA

Gene: BbifN4_010100009055: Predicted transcription regulator of carbohydrate utilization, lacI family
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
Predicted transcription regulator of carbohydrate utilization, lacI family
GH43
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171

Gene: BbifN4_010100009050: Putative alpha-L-arabinofuranosidase, GH43 family
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1

Gene: BDP_2106: Putative alpha-L-arabinofuranosidase, GH43 family
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
Putative alpha-L-arabinofuranosidase, GH43 family
 
CRON 2.
BbifN4_010100009055
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
*
Bifidobacterium bifidum NCIMB 41171

Site:
position = -260
score = 5.2552
sequence = CCTTGTAACCGTTTACATCA

Gene: BbifN4_010100009055: Transcription regulator, LacI family
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
Transcription regulator, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD