Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog FruR - Bifidobacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode:
Biological process: Fructose utilization
Effector:
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 11 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bifidobacterium longum subsp. infantis ATCC 15697 4 1
Bifidobacterium adolescentis ATCC 15703 2 1
Bifidobacterium angulatum DSM 20098 2 1
Bifidobacterium animalis subsp. lactis AD011 2 1
Bifidobacterium bifidum NCIMB 41171 3 1
Bifidobacterium breve DSM 20213 4 1
Bifidobacterium dentium Bd1 4 2
Bifidobacterium gallicum DSM 20093 2 1
Bifidobacterium longum NCC2705 4 1
Gardnerella vaginalis 409-05
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
fruR
*
Bifidobacterium longum subsp. infantis ATCC 15697

Site:
position = -92
score = 7.38548
sequence = ATTAATTAACAGCGTTAATATCT

Gene: Blon_0878: Transcriptional regulator of fructose utilization, ROK family
*
Bifidobacterium adolescentis ATCC 15703

Site:
position = -68
score = 7.12239
sequence = ATCAATTAACGGCGTTAATATAT

Gene: BAD_1095: Transcriptional regulator of fructose utilization, ROK family
*
Bifidobacterium angulatum DSM 20098

Site:
position = -75
score = 7.05985
sequence = TTGTATTAACTGCGTTAATATCT

Gene: BIFANG_01659: Transcriptional regulator of fructose utilization, ROK family
*
Bifidobacterium animalis subsp. lactis AD011

Site:
position = -96
score = 7.25451
sequence = ATGTATTAACTGCGTTAATATAT

Site:
position = -79
score = 5.6094
sequence = ATATATAAACATCGTTAACACAT

Gene: BLA_0755: Transcriptional regulator of fructose utilization, ROK family
*
Bifidobacterium bifidum NCIMB 41171

Site:
position = -103
score = 7.17136
sequence = TTTGATTAACAGTGTTAATATAT

Gene: BbifN4_010100002369: Transcriptional regulator of fructose utilization, ROK family
*
Bifidobacterium breve DSM 20213

Site:
position = -91
score = 6.99293
sequence = ATAGATTAACTACGTTAATATCT

Gene: BIFBRE_01709: Transcriptional regulator of fructose utilization, ROK family
*
Bifidobacterium dentium Bd1

Site:
position = -69
score = 6.53908
sequence = TGACGTTAACAGCGTTAATATAT

Gene: BDP_1533: Transcriptional regulator of fructose utilization, ROK family
 
Bifidobacterium gallicum DSM 20093

Gene: BIFGAL_01106: Transcriptional regulator of fructose utilization, ROK family
*
Bifidobacterium longum NCC2705

Site:
position = -92
score = 7.28393
sequence = ATCAATTAACAGCGTTAATATCT

Gene: BL1340: Transcriptional regulator of fructose utilization, ROK family
 
Gardnerella vaginalis 409-05
Transcriptional regulator of fructose utilization, ROK family
fruK
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_0877: Fructokinase (EC 2.7.1.4)
 
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_1096: Fructokinase (EC 2.7.1.4)
 
Bifidobacterium angulatum DSM 20098

Gene: BIFANG_01660: Fructokinase (EC 2.7.1.4)
 
Bifidobacterium animalis subsp. lactis AD011

Gene: BLA_0756: Fructokinase (EC 2.7.1.4)
 
Bifidobacterium bifidum NCIMB 41171

Gene: BbifN4_010100002364: Fructokinase (EC 2.7.1.4)
 
Bifidobacterium breve DSM 20213

Gene: BIFBRE_01710: Fructokinase (EC 2.7.1.4)
 
Bifidobacterium dentium Bd1

Gene: BDP_1534: Fructokinase (EC 2.7.1.4)
*
Bifidobacterium gallicum DSM 20093

Site:
position = -211
score = 7.2681
sequence = ATTGATTAACTGTGTTAATATAT

Gene: BIFGAL_01109: Fructokinase (EC 2.7.1.4)
 
Bifidobacterium longum NCC2705

Gene: BL1339: Fructokinase (EC 2.7.1.4)
 
Gardnerella vaginalis 409-05

Gene: HMPREF0424_0462: Fructokinase (EC 2.7.1.4)
Fructokinase (EC 2.7.1.4)
PF06824
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_0876: Six-hairpin glycosidases superfamily protein
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213

Gene: BIFBRE_01536: Six-hairpin glycosidases superfamily protein
 
Bifidobacterium dentium Bd1

Gene: BDP_1535: Six-hairpin glycosidases superfamily protein
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705

Gene: BL1338: Six-hairpin glycosidases superfamily protein
 
Gardnerella vaginalis 409-05
Six-hairpin glycosidases superfamily protein
PF07221
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_0875: N-acylglucosamine 2-epimerase family protein
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011

Gene: BLA_0147: N-acylglucosamine 2-epimerase family protein
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213

Gene: BIFBRE_01537: N-acylglucosamine 2-epimerase family protein
*
Bifidobacterium dentium Bd1

Site:
position = -73
score = 6.3842
sequence = AGTGATTAACATAGTTAATACAT

Gene: BDP_1538: N-acylglucosamine 2-epimerase family protein
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705

Gene: BL1337: N-acylglucosamine 2-epimerase family protein
 
Gardnerella vaginalis 409-05
N-acylglucosamine 2-epimerase family protein
fruP
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171

Gene: BbifN4_010100002359: Predicted fructose transporter
 2
Bifidobacterium breve DSM 20213

Gene: BIFBRE_01712: Predicted fructose transporter

Gene: BIFBRE_01711: Predicted fructose transporter
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093

Gene: BIFGAL_01110: Predicted fructose transporter
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
Predicted fructose transporter
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD