Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog GntR - Bifidobacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Gluconate utilization
Effector: Gluconate
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bifidobacterium longum subsp. infantis ATCC 15697
Bifidobacterium adolescentis ATCC 15703
Bifidobacterium angulatum DSM 20098
Bifidobacterium animalis subsp. lactis AD011
Bifidobacterium bifidum NCIMB 41171
Bifidobacterium breve DSM 20213
Bifidobacterium dentium Bd1 3 2
Bifidobacterium gallicum DSM 20093
Bifidobacterium longum NCC2705
Gardnerella vaginalis 409-05
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
idnO
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
*
Bifidobacterium dentium Bd1

Site:
position = -91
score = 7.42686
sequence = TAGGGGTATCGATACACCTA

Gene: BDP_1687: Gluconate 5-dehydrogenase (EC 1.1.1.69)
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
Gluconate 5-dehydrogenase (EC 1.1.1.69)
gntP
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1

Gene: BDP_1688: Gluconate permease
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
Gluconate permease
 
CRON 2.
gntR
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
*
Bifidobacterium dentium Bd1

Site:
position = -177
score = 7.42686
sequence = TAGGTGTATCGATACCCCTA

Gene: BDP_1686: Transcriptional regulator for gluconate utilization, LacI family
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
Transcriptional regulator for gluconate utilization, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD