Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog BL0176 - Bifidobacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Carbohydrate metabolism
Effector:
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 9 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bifidobacterium adolescentis ATCC 15703 4 2
Bifidobacterium angulatum DSM 20098
Bifidobacterium animalis subsp. lactis AD011
Bifidobacterium bifidum NCIMB 41171
Bifidobacterium breve DSM 20213
Bifidobacterium dentium Bd1 4 2
Bifidobacterium gallicum DSM 20093
Bifidobacterium longum NCC2705 4 4
Gardnerella vaginalis 409-05
Bifidobacterium longum subsp. infantis ATCC 15697
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
PF07944
 
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_1529: Putative glycosyl hydrolase of unknown function, DUF1680
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1

Gene: BDP_2104: Putative glycosyl hydrolase of unknown function, DUF1680
 
Bifidobacterium gallicum DSM 20093
*
Bifidobacterium longum NCC2705

Site:
position = -55
score = 6.1587
sequence = CATATGTGCCGATACATATT

Gene: BL0174: Putative glycosyl hydrolase of unknown function, DUF1680
 
Gardnerella vaginalis 409-05
 
Bifidobacterium longum subsp. infantis ATCC 15697
Putative glycosyl hydrolase of unknown function, DUF1680
 
CRON 2.
nagA
*
Bifidobacterium adolescentis ATCC 15703

Site:
position = -92
score = 6.53414
sequence = TATATGTAACGATACATATA

Gene: BAD_1525: Alpha-N-acetylgalactosaminidase (EC 3.2.1.49)
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
*
Bifidobacterium dentium Bd1

Site:
position = -157
score = 6.77351
sequence = AATATGTACCGTTACATATA

Gene: BDP_2092: Alpha-N-acetylgalactosaminidase (EC 3.2.1.49)
 
Bifidobacterium gallicum DSM 20093
*
Bifidobacterium longum NCC2705

Site:
position = -183
score = 6.43625
sequence = AATATGTAACGGTACATACG

Gene: BL0177: Alpha-N-acetylgalactosaminidase (EC 3.2.1.49)
 
Gardnerella vaginalis 409-05
 
Bifidobacterium longum subsp. infantis ATCC 15697
Alpha-N-acetylgalactosaminidase (EC 3.2.1.49)
abfA
 
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_1524: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1

Gene: BDP_2091: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
 
Bifidobacterium gallicum DSM 20093
*
Bifidobacterium longum NCC2705

Site:
position = -197
score = 5.74783
sequence = AATATGTAACGGTACGTGTG

Site:
position = -75
score = 6.84024
sequence = AATATGTACCGTTACATATT

Gene: BL0181: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
 
Gardnerella vaginalis 409-05
 
Bifidobacterium longum subsp. infantis ATCC 15697
Alpha-N-arabinofuranosidase (EC 3.2.1.55)
 
CRON 3.
BAD_1526
*
Bifidobacterium adolescentis ATCC 15703

Site:
position = -148
score = 6.53414
sequence = TATATGTATCGTTACATATA

Gene: BAD_1526: Transcriptional regulator, LacI family
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
*
Bifidobacterium dentium Bd1

Site:
position = -175
score = 6.77351
sequence = TATATGTAACGGTACATATT

Gene: BDP_2093: Transcriptional regulator, LacI family
 
Bifidobacterium gallicum DSM 20093
*
Bifidobacterium longum NCC2705

Site:
position = -210
score = 6.43625
sequence = CGTATGTACCGTTACATATT

Gene: BL0176: Transcriptional regulator, LacI family
 
Gardnerella vaginalis 409-05
 
Bifidobacterium longum subsp. infantis ATCC 15697
Transcriptional regulator, LacI family
xynD
 
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_1527: Endo-1,4-beta-xylanase
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1

Gene: BDP_2094: Endo-1,4-beta-xylanase
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
 
Bifidobacterium longum subsp. infantis ATCC 15697
Endo-1,4-beta-xylanase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD