Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HrcA - Staphylococcaceae

Properties
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Staphylococcus aureus subsp. aureus N315 6 2
Staphylococcus capitis SK14 6 2
Staphylococcus epidermidis ATCC 12228 6 2
Staphylococcus carnosus subsp. carnosus TM300 6 2
Staphylococcus haemolyticus JCSC1435 6 2
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 6 2
Macrococcus caseolyticus JCSC5402 6 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
hrcA
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -38
score = 6.83023
sequence = TTAGCACTTGAGATAAGTGAGTGCTAA

Gene: SA1411: heat-inducible transcription repressor HrcA
*
Staphylococcus capitis SK14

Site:
position = -40
score = 7.03093
sequence = TTAGCACTTGAGAGAAAAGAGTGCTAA

Gene: STACA0001_1890: heat-inducible transcription repressor HrcA
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -38
score = 7.2182
sequence = TTAGCACTTGAGATAAAAGAGTGCTAA

Gene: SE1269: heat-inducible transcription repressor HrcA
*
Staphylococcus carnosus subsp. carnosus TM300

Site:
position = -38
score = 6.79858
sequence = TTAGCACTTGAGAGAAGAGAGTGCTAA

Gene: Sca_1204: heat-inducible transcription repressor HrcA
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -40
score = 6.87259
sequence = TTAGCACTTAGGACAAAAGAGTGCTAA

Gene: SH1334: heat-inducible transcription repressor HrcA
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -40
score = 6.9778
sequence = TTAGCACTTGAAACAAAAGAGTGCTAA

Gene: SSP1175: heat-inducible transcription repressor HrcA
*
Macrococcus caseolyticus JCSC5402

Site:
position = -37
score = 6.88337
sequence = TTAGCACTTGAGGTGATAGAGTGCTAA

Gene: MCCL_1234: heat-inducible transcriptional repressor HrcA
heat-inducible transcription repressor HrcA
grpE
 
Staphylococcus aureus subsp. aureus N315

Gene: SA1410: heat shock molecular chaperone protein GrpE
 
Staphylococcus capitis SK14

Gene: STACA0001_1891: heat shock molecular chaperone protein GrpE
 
Staphylococcus epidermidis ATCC 12228

Gene: SE1268: heat shock molecular chaperone protein GrpE
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_1203: heat shock molecular chaperone protein GrpE
 
Staphylococcus haemolyticus JCSC1435

Gene: SH1335: heat shock molecular chaperone protein GrpE
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP1176: heat shock molecular chaperone protein GrpE
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_1233: heat shock molecular chaperone protein GrpE
heat shock molecular chaperone protein GrpE
dnaK
 
Staphylococcus aureus subsp. aureus N315

Gene: SA1409: chaperone protein DnaK
 
Staphylococcus capitis SK14

Gene: STACA0001_1892: chaperone protein DnaK
 
Staphylococcus epidermidis ATCC 12228

Gene: SE1267: chaperone protein DnaK
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_1202: chaperone protein DnaK
 
Staphylococcus haemolyticus JCSC1435

Gene: SH1336: chaperone protein DnaK
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP1177: chaperone protein DnaK
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_1232: chaperone protein DnaK
chaperone protein DnaK
dnaJ
 
Staphylococcus aureus subsp. aureus N315

Gene: SA1408: chaperone protein dnaJ
 
Staphylococcus capitis SK14

Gene: STACA0001_1893: chaperone protein DnaJ
 
Staphylococcus epidermidis ATCC 12228

Gene: SE1266: chaperone protein dnaJ
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_1201: chaperone protein dnaJ
 
Staphylococcus haemolyticus JCSC1435

Gene: SH1337: chaperone protein dnaJ
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP1178: chaperone protein dnaJ
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_1231: chaperone protein DnaJ
chaperone protein dnaJ
 
CRON 2.
groES
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -54
score = 6.93658
sequence = TTAGCACTCTTTAATGTTAAGTGCTAA

Gene: SA1837: chaperonin GroES protein
*
Staphylococcus capitis SK14

Site:
position = -54
score = 7.17723
sequence = TTAGCACTCTAATAATTAAAGTGCTAA

Gene: STACA0001_1993: chaperonin GroES protein
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -54
score = 7.06742
sequence = TTAGCACTCTATATATCAAAGTGCTAA

Gene: SE1630: chaperonin GroES protein
*
Staphylococcus carnosus subsp. carnosus TM300

Site:
position = -98
score = 7.59754
sequence = TTAGCACTCAATAATCAAGAGTGCTAA

Gene: Sca_1541: chaperonin GroES protein
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -55
score = 7.03253
sequence = TTAGCACTCATTATATTTAAGTGCTAA

Gene: SH1001: chaperonin GroES protein
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -56
score = 7.02447
sequence = TTAGCACTCATTAACTTAAAGTGCTAA

Gene: SSP0847: chaperonin GroES protein
*
Macrococcus caseolyticus JCSC5402

Site:
position = -61
score = 7.12921
sequence = TTAGCACTATATATAAGAGAGTGCTAA

Gene: MCCL_1711: chaperonin GroES protein
chaperonin GroES protein
groEL
 
Staphylococcus aureus subsp. aureus N315

Gene: SA1836: chaperonin GroEL protein
 
Staphylococcus capitis SK14

Gene: STACA0001_1992: chaperonin GroEL protein
 
Staphylococcus epidermidis ATCC 12228

Gene: SE1629: chaperonin GroEL protein
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_1540: chaperonin GroEL protein
 
Staphylococcus haemolyticus JCSC1435

Gene: SH1002: chaperonin GroEL protein
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP0848: chaperonin GroEL protein
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_1710: chaperonin GroEL protein
chaperonin GroEL protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD