Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog FucR - Bifidobacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Fucose utilization
Effector: Fucose
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bifidobacterium longum subsp. infantis ATCC 15697 5 2
Bifidobacterium adolescentis ATCC 15703
Bifidobacterium angulatum DSM 20098
Bifidobacterium animalis subsp. lactis AD011
Bifidobacterium bifidum NCIMB 41171
Bifidobacterium breve DSM 20213 2 2
Bifidobacterium dentium Bd1
Bifidobacterium gallicum DSM 20093
Bifidobacterium longum NCC2705
Gardnerella vaginalis 409-05
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
fucD
*
Bifidobacterium longum subsp. infantis ATCC 15697

Site:
position = -87
score = 5.29717
sequence = AAAAATTTTCGTAATCGGGT

Gene: Blon_2309: L-fuconate dehydratase (EC 4.2.1.68)
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
*
Bifidobacterium breve DSM 20213

Site:
position = -88
score = 5.00083
sequence = AAAAATTTTCGCAAATAGGC

Gene: BIFBRE_00138: L-fuconate dehydratase (EC 4.2.1.68)
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
L-fuconate dehydratase (EC 4.2.1.68)
fucO
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_2308: Potentail L-fucose dehydrogenase
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213

Gene: BIFBRE_00140: Potentail L-fucose dehydrogenase
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
Potentail L-fucose dehydrogenase
fucP
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_2307: Potential L-fucose permease
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213

Gene: BIFBRE_00141: Potential L-fucose permease
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
Potential L-fucose permease
fucL
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_2306: Potential L-fucono-1,5-lactonase
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213

Gene: BIFBRE_00143: Potential L-fucono-1,5-lactonase
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
Potential L-fucono-1,5-lactonase
 
CRON 2.
fucR
*
Bifidobacterium longum subsp. infantis ATCC 15697

Site:
position = -112
score = 5.29717
sequence = ACCCGATTACGAAAATTTTT

Gene: Blon_2310: Transcriptional regulator of L-fucose utilization, LacI family
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
*
Bifidobacterium breve DSM 20213

Site:
position = 79
score = 5.00083
sequence = GCCTATTTGCGAAAATTTTT

Gene: BIFBRE_00139: Transcriptional regulator of L-fucose utilization, LacI family
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
Transcriptional regulator of L-fucose utilization, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD