Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog BfrR - Bifidobacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Fructooligosaccharides utilization
Effector:
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bifidobacterium longum subsp. infantis ATCC 15697 6 1
Bifidobacterium adolescentis ATCC 15703 6 1
Bifidobacterium angulatum DSM 20098 6 1
Bifidobacterium animalis subsp. lactis AD011
Bifidobacterium bifidum NCIMB 41171
Bifidobacterium breve DSM 20213
Bifidobacterium dentium Bd1
Bifidobacterium gallicum DSM 20093
Bifidobacterium longum NCC2705
Gardnerella vaginalis 409-05
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
bfrB
*
Bifidobacterium longum subsp. infantis ATCC 15697

Site:
position = -156
score = 5.91169
sequence = TGAGATAAACGATTAACATT

Site:
position = -135
score = 4.85406
sequence = GACATTAATCGATTAACGTC

Gene: Blon_2061: Putative fructooligosaccharide ABC transporter, substrate-binding component
*
Bifidobacterium adolescentis ATCC 15703

Site:
position = -141
score = 6.02227
sequence = TGAGATAAACGATTAACGTT

Site:
position = -120
score = 4.85406
sequence = GACATTAAACGATTAACGAT

Gene: BAD_1330: Putative fructooligosaccharide ABC transporter, substrate-binding component
*
Bifidobacterium angulatum DSM 20098

Site:
position = -140
score = 5.63618
sequence = TGGAATAATCGTTTAACGTT

Site:
position = -119
score = 4.85406
sequence = GACATTAAACGATTAACGAT

Gene: BIFANG_00830: Putative fructooligosaccharide ABC transporter, substrate-binding component
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
Putative fructooligosaccharide ABC transporter, substrate-binding component
bfrC
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_2060: Putative fructooligosaccharide ABC transporter, permease component 1
 
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_1329: Putative fructooligosaccharide ABC transporter, permease component 1
 
Bifidobacterium angulatum DSM 20098

Gene: BIFANG_00831: Putative fructooligosaccharide ABC transporter, permease component 1
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
Putative fructooligosaccharide ABC transporter, permease component 1
bfrD
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_2059: Putative fructooligosaccharide ABC transporter, permease component 2
 
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_1328: Putative fructooligosaccharide ABC transporter, permease component 2
 
Bifidobacterium angulatum DSM 20098

Gene: BIFANG_00832: Putative fructooligosaccharide ABC transporter, permease component 2
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
Putative fructooligosaccharide ABC transporter, permease component 2
PF04854
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_2058: Predicted integral membrane protein, DUF624
 
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_1327: Predicted integral membrane protein, DUF624
 
Bifidobacterium angulatum DSM 20098

Gene: BIFANG_00833: Predicted integral membrane protein, DUF624
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
Predicted integral membrane protein, DUF624
bfrR
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_2057: Putative transcriptional regulator of fructooligosaccharide utilization, LacI-family
 
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_1326: Putative transcriptional regulator of fructooligosaccharide utilization, LacI-family
 
Bifidobacterium angulatum DSM 20098

Gene: BIFANG_00834: Putative transcriptional regulator of fructooligosaccharide utilization, LacI-family
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
Putative transcriptional regulator of fructooligosaccharide utilization, LacI-family
bfrA
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_2056: Beta-fructosidase (EC 3.2.1.26)
 
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_1325: Beta-fructosidase (EC 3.2.1.26)
 
Bifidobacterium angulatum DSM 20098

Gene: BIFANG_00835: Beta-fructosidase (EC 3.2.1.26)
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
Beta-fructosidase (EC 3.2.1.26)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD