Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog AraQ - Bifidobacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Central carbohydrate metabolism; Arabinose utilization; Arabinose oligosaccharide utilization
Effector:
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 83 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bifidobacterium longum subsp. infantis ATCC 15697 16 12
Bifidobacterium adolescentis ATCC 15703 14 10
Bifidobacterium angulatum DSM 20098 8 5
Bifidobacterium animalis subsp. lactis AD011 5 3
Bifidobacterium bifidum NCIMB 41171 13 9
Bifidobacterium breve DSM 20213 15 11
Bifidobacterium dentium Bd1 12 9
Bifidobacterium gallicum DSM 20093 5 3
Bifidobacterium longum NCC2705 19 13
Gardnerella vaginalis 409-05 3 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
eno
*
Bifidobacterium longum subsp. infantis ATCC 15697

Site:
position = -108
score = 5.96145
sequence = CATTGTGAGCGCTAACACTA

Gene: Blon_1836: Enolase (EC 4.2.1.11)
*
Bifidobacterium adolescentis ATCC 15703

Site:
position = -106
score = 5.2918
sequence = GAGTGTGAGCGTTCACATGG

Gene: BAD_0645: Enolase (EC 4.2.1.11)
 
Bifidobacterium angulatum DSM 20098

Gene: BIFANG_01071: Enolase (EC 4.2.1.11)
*
Bifidobacterium animalis subsp. lactis AD011

Site:
position = -104
score = 5.18325
sequence = TCGTGGGAGCGCTCACATTT

Gene: BLA_1030: Enolase (EC 4.2.1.11)
*
Bifidobacterium bifidum NCIMB 41171

Site:
position = -105
score = 5.32738
sequence = GAATGTTAGCGCTCATATTA

Gene: BbifN4_010100003174: Enolase (EC 4.2.1.11)
*
Bifidobacterium breve DSM 20213

Site:
position = -108
score = 6.1265
sequence = CATTGTGAGCGCTCACATCA

Gene: BIFBRE_01016: Enolase (EC 4.2.1.11)
*
Bifidobacterium dentium Bd1

Site:
position = -106
score = 5.48783
sequence = GTATGTGAGCGTTCACATGA

Gene: BDP_0870: Enolase (EC 4.2.1.11)
*
Bifidobacterium gallicum DSM 20093

Site:
position = -104
score = 4.47569
sequence = ACATGTGAACACTCACTGCA

Gene: BIFGAL_01223: Enolase (EC 4.2.1.11)
*
Bifidobacterium longum NCC2705

Site:
position = -108
score = 5.64402
sequence = CATTGTGAGCGCTAACGCTA

Gene: BL1022: Enolase (EC 4.2.1.11)
*
Gardnerella vaginalis 409-05

Site:
position = -106
score = 5.28629
sequence = TATTGTGAACGTTCACGGCA

Gene: HMPREF0424_0662: Enolase (EC 4.2.1.11)
Enolase (EC 4.2.1.11)
 
CRON 2.
araQ
*
Bifidobacterium longum subsp. infantis ATCC 15697

Site:
position = -110
score = 5.46808
sequence = CAGTGTGAGCGCTAACGCAA

Gene: Blon_0423: Transcriptional regulator of central carbohydrate metabolism, LacI family
*
Bifidobacterium adolescentis ATCC 15703

Site:
position = -75
score = 5.42377
sequence = GGTTGTTAGCGCTAACTGAA

Gene: BAD_1413: Transcriptional regulator of central carbohydrate metabolism, LacI family
 
Bifidobacterium angulatum DSM 20098

Gene: BIFANG_00190: Transcriptional regulator of central carbohydrate metabolism, LacI family
 
Bifidobacterium animalis subsp. lactis AD011

Gene: BLA_0050: Transcriptional regulator of central carbohydrate metabolism, LacI family
*
Bifidobacterium bifidum NCIMB 41171

Site:
position = -122
score = 5.42384
sequence = ATCTGTGAGCGCTCACGCGT

Gene: BbifN4_010100001372: Transcriptional regulator of central carbohydrate metabolism, LacI family
*
Bifidobacterium breve DSM 20213

Site:
position = -146
score = 5.43068
sequence = CAATGTGAGCGCTCACGCGA

Gene: BIFBRE_02212: Transcriptional regulator of central carbohydrate metabolism, LacI family
*
Bifidobacterium dentium Bd1

Site:
position = -75
score = 5.1259
sequence = GCCTGTTAGCGCTAACTGAA

Gene: BDP_1926: Transcriptional regulator of central carbohydrate metabolism, LacI family
 
Bifidobacterium gallicum DSM 20093

Gene: BIFGAL_00652: Transcriptional regulator of central carbohydrate metabolism, LacI family
*
Bifidobacterium longum NCC2705

Site:
position = -71
score = 5.46808
sequence = CAGTGTGAGCGCTAACGCAA

Gene: BL0275: Transcriptional regulator of central carbohydrate metabolism, LacI family
 
Gardnerella vaginalis 409-05

Gene: HMPREF0424_0351: Transcriptional regulator of central carbohydrate metabolism, LacI family
Transcriptional regulator of central carbohydrate metabolism, LacI family
 
CRON 3.
glgB
*
Bifidobacterium longum subsp. infantis ATCC 15697

Site:
position = -108
score = 5.3485
sequence = CTATGAGAGCGCTCACAACC

Gene: Blon_1761: 1,4-alpha-glucan (glycogen) branching enzyme, GH-13-type (EC 2.4.1.18)
 
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_0667: 1,4-alpha-glucan (glycogen) branching enzyme, GH-13-type (EC 2.4.1.18)
 
Bifidobacterium angulatum DSM 20098

Gene: BIFANG_01130: 1,4-alpha-glucan (glycogen) branching enzyme, GH-13-type (EC 2.4.1.18)
 
Bifidobacterium animalis subsp. lactis AD011

Gene: BLA_1505: 1,4-alpha-glucan (glycogen) branching enzyme, GH-13-type (EC 2.4.1.18)
 
Bifidobacterium bifidum NCIMB 41171

Gene: BbifN4_010100003289: 1,4-alpha-glucan (glycogen) branching enzyme, GH-13-type (EC 2.4.1.18)
*
Bifidobacterium breve DSM 20213

Site:
position = -108
score = 5.42046
sequence = CAATGAGAGCGCTCACAATC

Gene: BIFBRE_01039: 1,4-alpha-glucan (glycogen) branching enzyme, GH-13-type (EC 2.4.1.18)
 
Bifidobacterium dentium Bd1

Gene: BDP_0893: 1,4-alpha-glucan (glycogen) branching enzyme, GH-13-type (EC 2.4.1.18)
 
Bifidobacterium gallicum DSM 20093

Gene: BIFGAL_00368: 1,4-alpha-glucan (glycogen) branching enzyme, GH-13-type (EC 2.4.1.18)
*
Bifidobacterium longum NCC2705

Site:
position = -147
score = 5.3485
sequence = CTATGAGAGCGCTCACAACC

Gene: BL0999: 1,4-alpha-glucan (glycogen) branching enzyme, GH-13-type (EC 2.4.1.18)
 
Gardnerella vaginalis 409-05

Gene: HMPREF0424_0597: 1,4-alpha-glucan (glycogen) branching enzyme, GH-13-type (EC 2.4.1.18)
1,4-alpha-glucan (glycogen) branching enzyme, GH-13-type (EC 2.4.1.18)
Blon_1762
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_1762: response regulator of two-component system
 
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_0666: response regulator of two-component system
 
Bifidobacterium angulatum DSM 20098

Gene: BIFANG_01129: response regulator of two-component system
 
Bifidobacterium animalis subsp. lactis AD011

Gene: BLA_1506: response regulator of two-component system
 
Bifidobacterium bifidum NCIMB 41171

Gene: BbifN4_010100003284: response regulator of two-component system
 
Bifidobacterium breve DSM 20213

Gene: BIFBRE_01038: response regulator of two-component system
 
Bifidobacterium dentium Bd1

Gene: BDP_0892: response regulator of two-component system
 
Bifidobacterium gallicum DSM 20093

Gene: BIFGAL_00369: response regulator of two-component system
 
Bifidobacterium longum NCC2705

Gene: BL1000: response regulator of two-component system
 
Gardnerella vaginalis 409-05

Gene: HMPREF0424_0596: response regulator of two-component system
response regulator of two-component system
Blon_1763
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_1763: histidine kinase sensor of two-component system
 
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_0665: histidine kinase sensor of two-component system
 
Bifidobacterium angulatum DSM 20098

Gene: BIFANG_01128: histidine kinase sensor of two-component system
 
Bifidobacterium animalis subsp. lactis AD011

Gene: BLA_1507: histidine kinase sensor of two-component system
 
Bifidobacterium bifidum NCIMB 41171

Gene: BbifN4_010100003279: histidine kinase sensor of two-component system
 
Bifidobacterium breve DSM 20213

Gene: BIFBRE_01037: histidine kinase sensor of two-component system
 
Bifidobacterium dentium Bd1

Gene: BDP_0891: histidine kinase sensor of two-component system
 
Bifidobacterium gallicum DSM 20093

Gene: BIFGAL_00370: histidine kinase sensor of two-component system
 
Bifidobacterium longum NCC2705

Gene: BL1001: histidine kinase sensor of two-component system
 
Gardnerella vaginalis 409-05

Gene: HMPREF0424_0594: histidine kinase sensor of two-component system
histidine kinase sensor of two-component system
 
CRON 4.
tkt
*
Bifidobacterium longum subsp. infantis ATCC 15697

Site:
position = -156
score = 5.29383
sequence = CACTGTGAACGTTAACAGAA

Gene: Blon_1096: Transketolase (EC 2.2.1.1)
*
Bifidobacterium adolescentis ATCC 15703

Site:
position = -156
score = 6.05322
sequence = AATTGTGAGCGCTAACAGCA

Gene: BAD_0829: Transketolase (EC 2.2.1.1)
*2
Bifidobacterium angulatum DSM 20098

Site:
position = -166
score = 4.73793
sequence = AAACGAGAACGCTAACAGAA

Gene: BIFANG_01436: Transketolase (EC 2.2.1.1)

Gene: BIFANG_01437: Transketolase (EC 2.2.1.1)
 
Bifidobacterium animalis subsp. lactis AD011

Gene: BLA_1357: Transketolase (EC 2.2.1.1)
*
Bifidobacterium bifidum NCIMB 41171

Site:
position = -159
score = 5.8219
sequence = ACTTGTGAGCGCTAACATAA

Gene: BbifN4_010100004774: Transketolase (EC 2.2.1.1)
*
Bifidobacterium breve DSM 20213

Site:
position = -156
score = 5.76995
sequence = AATTGTGAACGCTAACAGAA

Gene: BIFBRE_01332: Transketolase (EC 2.2.1.1)
*
Bifidobacterium dentium Bd1

Site:
position = -157
score = 5.70118
sequence = CATTGTGAACGCTAACAGAA

Gene: BDP_1145: Transketolase (EC 2.2.1.1)
 
Bifidobacterium gallicum DSM 20093

Gene: BIFGAL_01683: Transketolase (EC 2.2.1.1)
*
Bifidobacterium longum NCC2705

Site:
position = -156
score = 5.6202
sequence = CACTGTGAACGCTAACAGAA

Gene: BL0716: Transketolase (EC 2.2.1.1)
 
Gardnerella vaginalis 409-05

Gene: HMPREF0424_0902: Transketolase (EC 2.2.1.1)
Transketolase (EC 2.2.1.1)
tal
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_1095: Transaldolase (EC 2.2.1.2)
 
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_0830: Transaldolase (EC 2.2.1.2)
 
Bifidobacterium angulatum DSM 20098

Gene: BIFANG_01438: Transaldolase (EC 2.2.1.2)
 
Bifidobacterium animalis subsp. lactis AD011

Gene: BLA_1358: Transaldolase (EC 2.2.1.2)
 
Bifidobacterium bifidum NCIMB 41171

Gene: BbifN4_010100004779: Transaldolase (EC 2.2.1.2)
 
Bifidobacterium breve DSM 20213

Gene: BIFBRE_01331: Transaldolase (EC 2.2.1.2)
 
Bifidobacterium dentium Bd1

Gene: BDP_1144: Transaldolase (EC 2.2.1.2)
 
Bifidobacterium gallicum DSM 20093

Gene: BIFGAL_01684: Transaldolase (EC 2.2.1.2)
 
Bifidobacterium longum NCC2705

Gene: BL0715: Transaldolase (EC 2.2.1.2)
 
Gardnerella vaginalis 409-05

Gene: HMPREF0424_0903: Transaldolase (EC 2.2.1.2)
Transaldolase (EC 2.2.1.2)
 
CRON 5.
gap
*
Bifidobacterium longum subsp. infantis ATCC 15697

Site:
position = -155
score = 6.31934
sequence = AATTGTGAGCGCTCACAAAA

Gene: Blon_0900: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
*
Bifidobacterium adolescentis ATCC 15703

Site:
position = -156
score = 5.08363
sequence = GCATGTGAGCGTTCACTGAA

Gene: BAD_1079: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
 
Bifidobacterium angulatum DSM 20098

Gene: BIFANG_01637: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
 
Bifidobacterium animalis subsp. lactis AD011

Gene: BLA_0740: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
*
Bifidobacterium bifidum NCIMB 41171

Site:
position = -155
score = 5.29604
sequence = ATTTGTTAGCGTTAACGGAA

Gene: BbifN4_010100002494: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
*
Bifidobacterium breve DSM 20213

Site:
position = -155
score = 6.16959
sequence = CAATGTGAGCGCTCACAAAA

Gene: BIFBRE_01690: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
*
Bifidobacterium dentium Bd1

Site:
position = -156
score = 5.5258
sequence = CATTGTGAGCGTTCACGGAA

Gene: BDP_1514: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
 
Bifidobacterium gallicum DSM 20093

Gene: BIFGAL_00267: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
*
Bifidobacterium longum NCC2705

Site:
position = -155
score = 6.23836
sequence = AATTGTGAGCGCTCACAGAA

Gene: BL1363: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
*
Gardnerella vaginalis 409-05

Site:
position = -161
score = 4.89485
sequence = GCATGTTAACGCTCACTGTT

Gene: HMPREF0424_0471: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
 
CRON 6.
ldh
*
Bifidobacterium longum subsp. infantis ATCC 15697

Site:
position = -160
score = 5.28743
sequence = GTTTGGGAGCGCTAACAACC

Gene: Blon_0840: L-lactate dehydrogenase (EC 1.1.1.27)
*
Bifidobacterium adolescentis ATCC 15703

Site:
position = -23
score = 6.15515
sequence = GTATGTGAGCGCTCACAAAA

Gene: BAD_1117: L-lactate dehydrogenase (EC 1.1.1.27)
*
Bifidobacterium angulatum DSM 20098

Site:
position = -102
score = 4.7004
sequence = CGATGTGAGCGCTGCCAGTG

Gene: BIFANG_00987: L-lactate dehydrogenase (EC 1.1.1.27)
 
Bifidobacterium animalis subsp. lactis AD011

Gene: BLA_0792: L-lactate dehydrogenase (EC 1.1.1.27)
*
Bifidobacterium bifidum NCIMB 41171

Site:
position = -163
score = 5.7857
sequence = GTCTGTGAGCGTTCACAACA

Gene: BbifN4_010100002254: L-lactate dehydrogenase (EC 1.1.1.27)
*
Bifidobacterium breve DSM 20213

Site:
position = -160
score = 5.86575
sequence = GGCTGTGAGCGCTAACAACT

Gene: BIFBRE_01807: L-lactate dehydrogenase (EC 1.1.1.27)
*
Bifidobacterium dentium Bd1

Site:
position = -162
score = 6.11206
sequence = GTTTGTGAGCGCTCACATCA

Gene: BDP_1558: L-lactate dehydrogenase (EC 1.1.1.27)
 
Bifidobacterium gallicum DSM 20093

Gene: BIFGAL_00305: L-lactate dehydrogenase (EC 1.1.1.27)
*
Bifidobacterium longum NCC2705

Site:
position = -160
score = 5.6724
sequence = ATTCGTGAGCGCTAACAACC

Gene: BL1308: L-lactate dehydrogenase (EC 1.1.1.27)
 
Gardnerella vaginalis 409-05

Gene: HMPREF0424_0584: L-lactate dehydrogenase (EC 1.1.1.27)
L-lactate dehydrogenase (EC 1.1.1.27)
 
CRON 7.
galM
*2
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_0897: Aldose 1-epimerase (EC 5.1.3.3)

Site:
position = -43
score = 5.3759
sequence = GATTGTGAGCGGTAACAATC

Gene: Blon_0896: Aldose 1-epimerase (EC 5.1.3.3)
*
Bifidobacterium adolescentis ATCC 15703

Site:
position = -57
score = 4.96306
sequence = CATCGTGAGCGGTAACATAG

Gene: BAD_1082: Aldose 1-epimerase (EC 5.1.3.3)
*
Bifidobacterium angulatum DSM 20098

Site:
position = -51
score = 5.06915
sequence = ATGTGTTAGCGGTAACAACC

Gene: BIFANG_01641: Aldose 1-epimerase (EC 5.1.3.3)
 
Bifidobacterium animalis subsp. lactis AD011

Gene: BLA_0743: Aldose 1-epimerase (EC 5.1.3.3)
*
Bifidobacterium bifidum NCIMB 41171

Site:
position = -44
score = 4.46802
sequence = GATAGCGAGCGGTAACAATA

Gene: BbifN4_010100002474: Aldose 1-epimerase (EC 5.1.3.3)
*2
Bifidobacterium breve DSM 20213

Gene: BIFBRE_01693: Aldose 1-epimerase (EC 5.1.3.3)

Site:
position = -44
score = 4.87222
sequence = GATTGCGAGCGGTAACAATA

Gene: BIFBRE_01694: Aldose 1-epimerase (EC 5.1.3.3)
*
Bifidobacterium dentium Bd1

Site:
position = -56
score = 4.77792
sequence = GACCGTTAGCGGTAACAACC

Gene: BDP_1518: Aldose 1-epimerase (EC 5.1.3.3)
 
Bifidobacterium gallicum DSM 20093

Gene: BIFGAL_00270: Aldose 1-epimerase (EC 5.1.3.3)
*2
Bifidobacterium longum NCC2705

Gene: BL1360: Aldose 1-epimerase (EC 5.1.3.3)

Site:
position = -43
score = 5.44467
sequence = GATTGTGAGCGATAACAATT

Gene: BL1359: Aldose 1-epimerase (EC 5.1.3.3)
 
Gardnerella vaginalis 409-05
Aldose 1-epimerase (EC 5.1.3.3)
 
CRON 8.
araE
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
*
Bifidobacterium angulatum DSM 20098

Site:
position = -347
score = 5.28202
sequence = TTTTGAGAGCGTTCACATCA

Site:
position = -176
score = 5.35149
sequence = AAATGTGAGCGATAACATTT

Gene: BIFANG_00188: L-arabinose-proton symporter
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
L-arabinose-proton symporter
araB
 
Bifidobacterium longum subsp. infantis ATCC 15697
*
Bifidobacterium adolescentis ATCC 15703

Site:
position = -82
score = 5.25024
sequence = AATAGTGAGCGTTAACAGTG

Site:
position = -69
score = 5.49563
sequence = AACAGTGAGCGCTAACATTC

Gene: BAD_1412: Ribulokinase (EC 2.7.1.16)
 
Bifidobacterium angulatum DSM 20098

Gene: BIFANG_00187: Ribulokinase (EC 2.7.1.16)
*
Bifidobacterium animalis subsp. lactis AD011

Site:
position = -70
score = 5.92037
sequence = TTGTGTGAGCGCTAACATAT

Site:
position = -213
score = 5.00598
sequence = TCATGTTACCGCTCACAAGA

Gene: BLA_0056: Ribulokinase (EC 2.7.1.16)
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
*
Bifidobacterium dentium Bd1

Site:
position = -81
score = 5.25024
sequence = AATAGTGAGCGTTAACAGTG

Site:
position = -68
score = 5.49563
sequence = AACAGTGAGCGCTAACATTC

Gene: BDP_1924: Ribulokinase (EC 2.7.1.16)
*
Bifidobacterium gallicum DSM 20093

Site:
position = -2
score = 5.74335
sequence = AAATGTTAGCGCTAACATAC

Gene: BIFGAL_00651: Ribulokinase (EC 2.7.1.16)
*
Bifidobacterium longum NCC2705

Site:
position = -70
score = 5.84275
sequence = AATTGTGAGCGCTAACACCC

Gene: BL0274: Ribulokinase (EC 2.7.1.16)
 
Gardnerella vaginalis 409-05
Ribulokinase (EC 2.7.1.16)
araD
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_1411: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
 
Bifidobacterium angulatum DSM 20098

Gene: BIFANG_00186: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
 
Bifidobacterium animalis subsp. lactis AD011

Gene: BLA_0057: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
 
Bifidobacterium bifidum NCIMB 41171

Gene: BbifN4_010100001352: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1

Gene: BDP_1923: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
 
Bifidobacterium gallicum DSM 20093

Gene: BIFGAL_00650: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
 
Bifidobacterium longum NCC2705

Gene: BL0273: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
 
Gardnerella vaginalis 409-05
L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
araA
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_1410: L-arabinose isomerase (EC 5.3.1.4)
 
Bifidobacterium angulatum DSM 20098

Gene: BIFANG_00185: L-arabinose isomerase (EC 5.3.1.4)
 
Bifidobacterium animalis subsp. lactis AD011

Gene: BLA_0058: L-arabinose isomerase (EC 5.3.1.4)
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1

Gene: BDP_1922: L-arabinose isomerase (EC 5.3.1.4)
 
Bifidobacterium gallicum DSM 20093

Gene: BIFGAL_00649: L-arabinose isomerase (EC 5.3.1.4)
 
Bifidobacterium longum NCC2705

Gene: BL0272: L-arabinose isomerase (EC 5.3.1.4)
 
Gardnerella vaginalis 409-05
L-arabinose isomerase (EC 5.3.1.4)
gatC
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
*
Bifidobacterium bifidum NCIMB 41171

Site:
position = -238
score = 5.54357
sequence = ATATGTGAGCGCTCCCAATT

Gene: BbifN4_010100001337: putative PTS system, galactitol-specific IIC component
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
putative PTS system, galactitol-specific IIC component
lyxK
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171

Gene: BbifN4_010100001342: L-xylulose kinase (EC 2.7.1.-)
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
L-xylulose kinase (EC 2.7.1.-)
sgaU
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171

Gene: BbifN4_010100001347: L-xylulose 5-phosphate 3-epimerase (EC 5.1.3.-)
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
L-xylulose 5-phosphate 3-epimerase (EC 5.1.3.-)
 
CRON 9.
sgaR
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
*
Bifidobacterium bifidum NCIMB 41171

Site:
position = -130
score = 5.54357
sequence = AATTGGGAGCGCTCACATAT

Gene: BbifN4_010100001332: Putative transcriptional regulator of L-ascorbate utilization, SorC family
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
Putative transcriptional regulator of L-ascorbate utilization, SorC family
 
CRON 10.
pyk
*
Bifidobacterium longum subsp. infantis ATCC 15697

Site:
position = -127
score = 6.1265
sequence = CAATGTGAGCGCTCACAACA

Gene: Blon_1745: Pyruvate kinase (EC 2.7.1.40)
*
Bifidobacterium adolescentis ATCC 15703

Site:
position = -51
score = 6.27625
sequence = AATTGTGAGCGCTCACAACA

Gene: BAD_0678: Pyruvate kinase (EC 2.7.1.40)
*
Bifidobacterium angulatum DSM 20098

Site:
position = -131
score = 6.09631
sequence = AATTGTTAGCGCTCACATAA

Gene: BIFANG_01141: Pyruvate kinase (EC 2.7.1.40)
*
Bifidobacterium animalis subsp. lactis AD011

Site:
position = -380
score = 5.98212
sequence = GGTTGTGAGCGCTCACAGAC

Gene: BLA_1494: Pyruvate kinase (EC 2.7.1.40)
*
Bifidobacterium bifidum NCIMB 41171

Site:
position = -131
score = 6.13774
sequence = AGATGTGAGCGCTCACAACA

Gene: BbifN4_010100003349: Pyruvate kinase (EC 2.7.1.40)
*
Bifidobacterium breve DSM 20213

Site:
position = -77
score = 6.04597
sequence = CAGTGTGAGCGCTCACAACA

Gene: BIFBRE_01051: Pyruvate kinase (EC 2.7.1.40)
*
Bifidobacterium dentium Bd1

Site:
position = -126
score = 6.19527
sequence = AAATGTGAGCGCTCACAACA

Gene: BDP_0904: Pyruvate kinase (EC 2.7.1.40)
*
Bifidobacterium gallicum DSM 20093

Site:
position = -125
score = 5.5016
sequence = CTATGTTAACGCTAACAACA

Gene: BIFGAL_00353: Pyruvate kinase (EC 2.7.1.40)
*
Bifidobacterium longum NCC2705

Site:
position = -40
score = 6.1265
sequence = CAATGTGAGCGCTCACAACA

Gene: BL0988: Pyruvate kinase (EC 2.7.1.40)
*
Gardnerella vaginalis 409-05

Site:
position = -146
score = 5.95873
sequence = TTCTGTGAGCGTTCACAAAA

Gene: HMPREF0424_0607: Pyruvate kinase (EC 2.7.1.40)
Pyruvate kinase (EC 2.7.1.40)
 
CRON 11.
PF07944
 
Bifidobacterium longum subsp. infantis ATCC 15697
*
Bifidobacterium adolescentis ATCC 15703

Site:
position = -49
score = 5.52218
sequence = GATTGTGAGCGTTAACAAGA

Gene: BAD_1529: Putative glycosyl hydrolase of unknown function (DUF1680)
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1

Gene: BDP_2104: Putative glycosyl hydrolase of unknown function (DUF1680)
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705

Gene: BL0174: Putative glycosyl hydrolase of unknown function (DUF1680)
 
Gardnerella vaginalis 409-05
Putative glycosyl hydrolase of unknown function (DUF1680)
aga
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_1528: Alpha-galactosidase (EC 3.2.1.22)
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011

Gene: BLA_0881: Alpha-galactosidase (EC 3.2.1.22)
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1

Gene: BDP_2102: Alpha-galactosidase (EC 3.2.1.22)
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
Alpha-galactosidase (EC 3.2.1.22)
 
CRON 12.
maa
 
Bifidobacterium longum subsp. infantis ATCC 15697
*
Bifidobacterium adolescentis ATCC 15703

Site:
position = -20
score = 5.44535
sequence = TGGTGTGAGCGTTCACTATA

Gene: BAD_0431: Maltose O-acetyltransferase (EC 2.3.1.79)
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
*
Bifidobacterium dentium Bd1

Site:
position = -49
score = 5.51768
sequence = TTGCGTGAACGCTCACAACA

Gene: BDP_0569: Maltose O-acetyltransferase (EC 2.3.1.79)
 
Bifidobacterium gallicum DSM 20093

Gene: BIFGAL_00985: Maltose O-acetyltransferase (EC 2.3.1.79)
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
Maltose O-acetyltransferase (EC 2.3.1.79)
 
CRON 13.
malQ1
*
Bifidobacterium longum subsp. infantis ATCC 15697

Site:
position = -110
score = 6.06533
sequence = CATTGTGAGCGCTCACATCT

Site:
position = -88
score = 4.59879
sequence = CTGTGTGAGGGCTAAAAGTA

Gene: Blon_2246: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
 
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_0308: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
 
Bifidobacterium angulatum DSM 20098

Gene: BIFANG_00703: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
 
Bifidobacterium animalis subsp. lactis AD011

Gene: BLA_0353: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
 
Bifidobacterium bifidum NCIMB 41171

Gene: BbifN4_010100007712: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1

Gene: BDP_0418: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
 
Bifidobacterium gallicum DSM 20093

Gene: BIFGAL_00789: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
*
Bifidobacterium longum NCC2705

Site:
position = -110
score = 6.06533
sequence = CATTGTGAGCGCTCACATCT

Gene: BL1570: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
 
Gardnerella vaginalis 409-05

Gene: HMPREF0424_0251: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
 
CRON 14.
birA
*
Bifidobacterium longum subsp. infantis ATCC 15697

Site:
position = -107
score = 4.91561
sequence = AGTTGTGAACGTTAACACGG

Gene: Blon_2288: Biotin-protein ligase (EC 6.3.4.15)
 
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_0251: Biotin-protein ligase (EC 6.3.4.15)
 
Bifidobacterium angulatum DSM 20098

Gene: BIFANG_00241: Biotin-protein ligase (EC 6.3.4.15)
 
Bifidobacterium animalis subsp. lactis AD011

Gene: BLA_0298: Biotin-protein ligase (EC 6.3.4.15)
 2
Bifidobacterium bifidum NCIMB 41171

Gene: BbifN4_010100007402: Biotin-protein ligase (EC 6.3.4.15)

Gene: BbifN4_010100007372: Biotin-protein ligase (EC 6.3.4.15)
*
Bifidobacterium breve DSM 20213

Site:
position = -107
score = 5.22251
sequence = ACGTGTGAGCGTTCACACCG

Gene: BIFBRE_00166: Biotin-protein ligase (EC 6.3.4.15)
 
Bifidobacterium dentium Bd1

Gene: BDP_0358: Biotin-protein ligase (EC 6.3.4.15)
 2
Bifidobacterium gallicum DSM 20093

Gene: BIFGAL_00711: Biotin-protein ligase (EC 6.3.4.15)

Gene: BIFGAL_00710: Biotin-protein ligase (EC 6.3.4.15)
*
Bifidobacterium longum NCC2705

Site:
position = -45
score = 4.99614
sequence = AGTTGTGAACGTTAACATGG

Gene: BL1533: Biotin-protein ligase (EC 6.3.4.15)
 
Gardnerella vaginalis 409-05

Gene: HMPREF0424_1201: Biotin-protein ligase (EC 6.3.4.15)
Biotin-protein ligase (EC 6.3.4.15)
 
CRON 15.
Blon_2289
*
Bifidobacterium longum subsp. infantis ATCC 15697

Site:
position = -144
score = 4.91561
sequence = CCGTGTTAACGTTCACAACT

Gene: Blon_2289: hypothetical protein
 
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_0250: hypothetical protein
 
Bifidobacterium angulatum DSM 20098

Gene: BIFANG_00391: hypothetical protein
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171

Gene: BbifN4_010100007367: hypothetical protein
*
Bifidobacterium breve DSM 20213

Site:
position = -213
score = 5.22251
sequence = CGGTGTGAACGCTCACACGT

Gene: BIFBRE_00165: hypothetical protein
 
Bifidobacterium dentium Bd1

Gene: BDP_0356: hypothetical protein
 
Bifidobacterium gallicum DSM 20093

Gene: BIFGAL_00707: hypothetical protein
*
Bifidobacterium longum NCC2705

Site:
position = -123
score = 4.99614
sequence = CCATGTTAACGTTCACAACT

Gene: BL1532: hypothetical protein
 
Gardnerella vaginalis 409-05

Gene: HMPREF0424_1202: hypothetical protein
hypothetical protein
Blon_2290
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_2290: Regulator of polyketide synthase expression
 
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_0249: Regulator of polyketide synthase expression
 
Bifidobacterium angulatum DSM 20098

Gene: BIFANG_00390: Regulator of polyketide synthase expression
 
Bifidobacterium animalis subsp. lactis AD011

Gene: BLA_0297: Regulator of polyketide synthase expression
 
Bifidobacterium bifidum NCIMB 41171

Gene: BbifN4_010100007362: Regulator of polyketide synthase expression
 
Bifidobacterium breve DSM 20213

Gene: BIFBRE_00164: Regulator of polyketide synthase expression
 
Bifidobacterium dentium Bd1

Gene: BDP_0355: Regulator of polyketide synthase expression
 
Bifidobacterium gallicum DSM 20093

Gene: BIFGAL_00705: Regulator of polyketide synthase expression
 
Bifidobacterium longum NCC2705

Gene: BL1531: Regulator of polyketide synthase expression
 
Gardnerella vaginalis 409-05

Gene: HMPREF0424_1203: Regulator of polyketide synthase expression
Regulator of polyketide synthase expression
 
CRON 16.
malE
*
Bifidobacterium longum subsp. infantis ATCC 15697

Site:
position = -227
score = 5.1073
sequence = ATATGTTAGCGCTCTCATGA

Gene: Blon_2444: Maltose/maltodextrin ABC transporter, substrate binding protein
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
*
Bifidobacterium breve DSM 20213

Site:
position = -229
score = 4.92302
sequence = GCATGTTAGCGCTCTCATTG

Gene: BIFBRE_00012: Maltose/maltodextrin ABC transporter, substrate binding protein
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
*
Bifidobacterium longum NCC2705

Site:
position = -246
score = 5.36728
sequence = ATATGTTAGCGCTCTCATAA

Gene: BL0141: Maltose/maltodextrin ABC transporter, substrate binding protein
 
Gardnerella vaginalis 409-05
Maltose/maltodextrin ABC transporter, substrate binding protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD