Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog GlvR - Staphylococcaceae

Properties
Regulator type: Transcription factor
Regulator family: RpiR
Regulation mode: activator
Biological process: Maltose utilization
Effector: Maltose-6-phosphate
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Staphylococcus aureus subsp. aureus N315 1 1
Staphylococcus capitis SK14 1 1
Staphylococcus epidermidis ATCC 12228 1 1
Staphylococcus carnosus subsp. carnosus TM300
Staphylococcus haemolyticus JCSC1435 1 1
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 1 1
Macrococcus caseolyticus JCSC5402
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
glvC
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -181
score = 7.60113
sequence = TGAAAAAATTTTCACTATATGAAAA

Gene: SA2114: maltose-specific PTS system, IIBC component
*
Staphylococcus capitis SK14

Site:
position = -190
score = 7.26727
sequence = TGAAAAAATTTCCGTTCAATGAAAA

Gene: STACA0001_1166: maltose-specific PTS system, IIBC component
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -181
score = 7.60113
sequence = TGAAAATATTTTCTTTATATGAAAA

Gene: SE1897: maltose-specific PTS system, IIBC component
 
Staphylococcus carnosus subsp. carnosus TM300
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -198
score = 7.36289
sequence = TGAAAATATTTTCATGTATAGAAAA

Gene: SH0732: maltose-specific PTS system, IIBC component
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -193
score = 7.39881
sequence = TGAAAATATTTTCAACTTTTGAAAA

Gene: SSP0583: maltose-specific PTS system, IIBC component
 
Macrococcus caseolyticus JCSC5402
maltose-specific PTS system, IIBC component
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD