Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HxlR - Bifidobacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Hexulose metabolism
Effector:
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bifidobacterium longum subsp. infantis ATCC 15697
Bifidobacterium adolescentis ATCC 15703
Bifidobacterium angulatum DSM 20098 5 1
Bifidobacterium animalis subsp. lactis AD011
Bifidobacterium bifidum NCIMB 41171
Bifidobacterium breve DSM 20213
Bifidobacterium dentium Bd1 5 1
Bifidobacterium gallicum DSM 20093
Bifidobacterium longum NCC2705
Gardnerella vaginalis 409-05
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
hxlP
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
*
Bifidobacterium angulatum DSM 20098

Site:
position = -83
score = 5.46115
sequence = AAACGTAACCGGTAAACTAA

Site:
position = -96
score = 5.60836
sequence = GTTGTTAACCGATAAACGTA

Site:
position = -131
score = 5.48331
sequence = GTAGTTAACCGGTACACATG

Gene: BIFANG_01235: Predicted hexulose permease
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
*
Bifidobacterium dentium Bd1

Site:
position = -97
score = 6.2838
sequence = ATAGTTAACCGGTAAACGAA

Site:
position = -132
score = 6.2838
sequence = GTAGTTAACCGGTAAACAAA

Gene: BDP_0010: Predicted hexulose permease
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
Predicted hexulose permease
usp
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098

Gene: BIFANG_01234: Predicted sugar phosphate isomerase/epimerase
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1

Gene: BDP_0011: Predicted sugar phosphate isomerase/epimerase
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
Predicted sugar phosphate isomerase/epimerase
hxlK
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098

Gene: BIFANG_01233: Predicted hexulose kinase
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1

Gene: BDP_0012: Predicted hexulose kinase
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
Predicted hexulose kinase
hxlA
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098

Gene: BIFANG_01232: 3-hexulose 6-phosphate formaldehyde-lyase
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1

Gene: BDP_0013: 3-hexulose 6-phosphate formaldehyde-lyase
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
3-hexulose 6-phosphate formaldehyde-lyase
hxlB
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098

Gene: BIFANG_01231: Predicted 6-phospho-3-hexuloisomerase
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1

Gene: BDP_0014: Predicted 6-phospho-3-hexuloisomerase
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
Predicted 6-phospho-3-hexuloisomerase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD