Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CscR - Bifidobacteria

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Sucrose utilization
Effector: Sucrose
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 16 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bifidobacterium longum subsp. infantis ATCC 15697 2 1
Bifidobacterium adolescentis ATCC 15703 2 1
Bifidobacterium angulatum DSM 20098 2 1
Bifidobacterium animalis subsp. lactis AD011 2 1
Bifidobacterium bifidum NCIMB 41171
Bifidobacterium breve DSM 20213 2 1
Bifidobacterium dentium Bd1 2 1
Bifidobacterium gallicum DSM 20093 2 1
Bifidobacterium longum NCC2705 2 1
Gardnerella vaginalis 409-05
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
cscB
*
Bifidobacterium longum subsp. infantis ATCC 15697

Site:
position = -134
score = 7.13008
sequence = GACGTCAATCGATTGACGTA

Site:
position = -120
score = 6.8378
sequence = GACGTAAATCGATTGACGTC

Gene: Blon_0788: Sucrose permease, major facilitator superfamily
*
Bifidobacterium adolescentis ATCC 15703

Site:
position = -70
score = 6.39319
sequence = GACGTCAAACGATTGACGAA

Site:
position = -84
score = 7.00405
sequence = GACGTCAAACGATTGACGTC

Gene: BAD_1149: Sucrose permease, major facilitator superfamily
*
Bifidobacterium angulatum DSM 20098

Site:
position = -12
score = 6.01236
sequence = GACGTAAATCGATTGACGCT

Site:
position = -26
score = 7.0572
sequence = TACGTCAATCGATTGACGTA

Gene: BIFANG_01828: Sucrose permease, major facilitator superfamily
*
Bifidobacterium animalis subsp. lactis AD011

Site:
position = -217
score = 6.27373
sequence = GAAGTCAATCGTTTGATGTC

Gene: BLA_0818: Sucrose permease, major facilitator superfamily
 
Bifidobacterium bifidum NCIMB 41171
*
Bifidobacterium breve DSM 20213

Site:
position = -114
score = 6.8378
sequence = GACGTAAATCGATTGACGTC

Site:
position = -128
score = 7.13008
sequence = GACGTCAATCGATTGACGTA

Gene: BIFBRE_00577: Sucrose permease, major facilitator superfamily
*
Bifidobacterium dentium Bd1

Site:
position = -158
score = 6.47264
sequence = GGCGTCAATCGATTTACGTC

Site:
position = -144
score = 6.84262
sequence = TACGTCAATCGATTGACGTG

Gene: BDP_1602: Sucrose permease, major facilitator superfamily
*
Bifidobacterium gallicum DSM 20093

Site:
position = -167
score = 6.10573
sequence = AACGTCAATCGTTTGACGCA

Site:
position = -121
score = 6.56601
sequence = TGCGTCAATCGTTTGACGTC

Site:
position = -107
score = 6.15252
sequence = GACGTCAAACGTTTGACGCG

Gene: BIFGAL_00341: Sucrose permease, major facilitator superfamily
*
Bifidobacterium longum NCC2705

Site:
position = -134
score = 7.0572
sequence = TACGTCAATCGATTGACGTA

Site:
position = -120
score = 6.8378
sequence = GACGTAAATCGATTGACGTC

Gene: BL0106: Sucrose permease, major facilitator superfamily
 
Gardnerella vaginalis 409-05
Sucrose permease, major facilitator superfamily
cscA
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_0787: Sucrase (EC 3.2.1.26)
 
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_1150: Sucrase (EC 3.2.1.26)
 
Bifidobacterium angulatum DSM 20098

Gene: BIFANG_01829: Sucrase (EC 3.2.1.26)
 
Bifidobacterium animalis subsp. lactis AD011

Gene: BLA_0819: Sucrase (EC 3.2.1.26)
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213

Gene: BIFBRE_00576: Sucrase (EC 3.2.1.26)
 
Bifidobacterium dentium Bd1

Gene: BDP_1603: Sucrase (EC 3.2.1.26)
 
Bifidobacterium gallicum DSM 20093

Gene: BIFGAL_00342: Sucrase (EC 3.2.1.26)
 
Bifidobacterium longum NCC2705

Gene: BL0105: Sucrase (EC 3.2.1.26)
 
Gardnerella vaginalis 409-05
Sucrase (EC 3.2.1.26)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD