Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog GosR - Bifidobacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Galactooligosaccharide utilization; Galactan utilization
Effector: Galactobiose
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 17 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bifidobacterium longum subsp. infantis ATCC 15697
Bifidobacterium adolescentis ATCC 15703 6 2
Bifidobacterium angulatum DSM 20098 3 1
Bifidobacterium animalis subsp. lactis AD011
Bifidobacterium bifidum NCIMB 41171 3 1
Bifidobacterium breve DSM 20213 1 1
Bifidobacterium dentium Bd1 5 3
Bifidobacterium gallicum DSM 20093
Bifidobacterium longum NCC2705 2 2
Gardnerella vaginalis 409-05
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
gosB2
 
Bifidobacterium longum subsp. infantis ATCC 15697
*
Bifidobacterium adolescentis ATCC 15703

Site:
position = -159
score = 5.27321
sequence = CAGGTACACAGTTATACCAA

Site:
position = -190
score = 4.85253
sequence = ATGGTACACCGGAAAACCTA

Gene: BAD_1405: Putative galactooligosaccharide ABC transporter, sugar-binding protein
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
Putative galactooligosaccharide ABC transporter, sugar-binding protein
gosC2
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_1404: Putative galactooligosaccharide ABC transporter, permease protein 1
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
Putative galactooligosaccharide ABC transporter, permease protein 1
gosD2
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_1403: Putative galactooligosaccharide ABC transporter, permease protein 2
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
Putative galactooligosaccharide ABC transporter, permease protein 2
bgaB2
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_1402: Beta-galactosidase (EC 3.2.1.23)
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
Beta-galactosidase (EC 3.2.1.23)
 
CRON 2.
galA
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
*
Bifidobacterium dentium Bd1

Site:
position = -29
score = 5.75047
sequence = TTGGTACAACGGTGTCTCTA

Gene: BDP_2054: Arabinogalactan endo-beta-1,4-galactanase (EC 3.2.1.89)
 
Bifidobacterium gallicum DSM 20093
*
Bifidobacterium longum NCC2705

Site:
position = -97
score = 4.95726
sequence = GTGGTACACAGCTGTACCGC

Site:
position = -147
score = 5.84454
sequence = TTGATACACCGGTTGACCAA

Gene: BL0257: Arabinogalactan endo-beta-1,4-galactanase (EC 3.2.1.89)
 
Gardnerella vaginalis 409-05
Arabinogalactan endo-beta-1,4-galactanase (EC 3.2.1.89)
 
CRON 3.
BbifN4_010100001412
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
*
Bifidobacterium bifidum NCIMB 41171

Site:
position = -39
score = 4.88967
sequence = CTGGTATAGCGGTGCATCAT

Site:
position = -11
score = 6.09143
sequence = TTGATACTCCGTTGTATCAA

Gene: BbifN4_010100001412: hypothetical protein
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
hypothetical protein
BbifN4_010100001417
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171

Gene: BbifN4_010100001417: hypothetical protein
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
hypothetical protein
PF00248
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_0442: Aldo/keto reductase
 
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_1396: Aldo/keto reductase
 
Bifidobacterium angulatum DSM 20098

Gene: BIFANG_00154: Aldo/keto reductase
 
Bifidobacterium animalis subsp. lactis AD011

Gene: BLA_0059: Aldo/keto reductase
 
Bifidobacterium bifidum NCIMB 41171

Gene: BbifN4_010100001422: Aldo/keto reductase
 
Bifidobacterium breve DSM 20213

Gene: BIFBRE_02227: Aldo/keto reductase
 
Bifidobacterium dentium Bd1

Gene: BDP_1903: Aldo/keto reductase
 
Bifidobacterium gallicum DSM 20093

Gene: BIFGAL_00641: Aldo/keto reductase
 
Bifidobacterium longum NCC2705

Gene: BL0255: Aldo/keto reductase
 
Gardnerella vaginalis 409-05
Aldo/keto reductase
bgaB
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_2123: Beta-galactosidase (EC 3.2.1.23), GH42 family
*
Bifidobacterium adolescentis ATCC 15703

Site:
position = -60
score = 6.05088
sequence = ATGCTACACCGGTGTACCAC

Gene: BAD_1401: Beta-galactosidase (EC 3.2.1.23), GH42 family
*
Bifidobacterium angulatum DSM 20098

Site:
position = 17
score = 5.88674
sequence = GTGGTACAACTGTGTATCAT

Gene: BIFANG_00156: Beta-galactosidase (EC 3.2.1.23), GH42 family
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171

Gene: BbifN4_010100000420: Beta-galactosidase (EC 3.2.1.23), GH42 family
 
Bifidobacterium breve DSM 20213

Gene: BIFBRE_02225: Beta-galactosidase (EC 3.2.1.23), GH42 family
*
Bifidobacterium dentium Bd1

Site:
position = -72
score = 6.1572
sequence = TTGCTACACCGTTGTATCAT

Gene: BDP_1908: Beta-galactosidase (EC 3.2.1.23), GH42 family
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705

Gene: BL0259: Beta-galactosidase (EC 3.2.1.23), GH42 family
 
Gardnerella vaginalis 409-05
Beta-galactosidase (EC 3.2.1.23), GH42 family
gosR
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_0439: Predicted transcriptional regulator of galactan utilization, LacI family
 
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_1400: Predicted transcriptional regulator of galactan utilization, LacI family
 
Bifidobacterium angulatum DSM 20098

Gene: BIFANG_00155: Predicted transcriptional regulator of galactan utilization, LacI family
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171

Gene: BbifN4_010100001407: Predicted transcriptional regulator of galactan utilization, LacI family
 
Bifidobacterium breve DSM 20213

Gene: BIFBRE_02226: Predicted transcriptional regulator of galactan utilization, LacI family
 
Bifidobacterium dentium Bd1

Gene: BDP_1907: Predicted transcriptional regulator of galactan utilization, LacI family
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705

Gene: BL0258: Predicted transcriptional regulator of galactan utilization, LacI family
 
Gardnerella vaginalis 409-05
Predicted transcriptional regulator of galactan utilization, LacI family
 
CRON 4.
gosB
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
*
Bifidobacterium breve DSM 20213

Site:
position = -260
score = 6.32638
sequence = TTGGTACACAGGTGTATCAT

Site:
position = -232
score = 5.58617
sequence = TTGGTACATGGGTGTACCAA

Gene: BIFBRE_02223: Putative galactooligosaccharide ABC transporter, substrate-binding component
*
Bifidobacterium dentium Bd1

Site:
position = -216
score = 5.94546
sequence = TTGATACAGCTGTGTATCAT

Site:
position = -188
score = 5.8045
sequence = ATGATACACAGTTGTATCAG

Site:
position = -98
score = 5.97821
sequence = TTGGTACAGCGGTATATCAA

Gene: BDP_1911: Putative galactooligosaccharide ABC transporter, substrate-binding component
 
Bifidobacterium gallicum DSM 20093
*
Bifidobacterium longum NCC2705

Site:
position = -253
score = 6.12709
sequence = TTGGTACACGGGTGTACCAA

Site:
position = -281
score = 6.32638
sequence = TTGGTACACAGGTGTATCAT

Gene: BL0262: Putative galactooligosaccharide ABC transporter, substrate-binding component
 
Gardnerella vaginalis 409-05
Putative galactooligosaccharide ABC transporter, substrate-binding component
gosC
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1

Gene: BDP_1910: Putative galactooligosaccharide ABC transporter, permease component 1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705

Gene: BL0261: Putative galactooligosaccharide ABC transporter, permease component 1
 
Gardnerella vaginalis 409-05
Putative galactooligosaccharide ABC transporter, permease component 1
gosD
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1

Gene: BDP_1909: Putative galactooligosaccharide ABC transporter, permease component 2
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705

Gene: BL0260: Putative galactooligosaccharide ABC transporter, permease component 2
 
Gardnerella vaginalis 409-05
Putative galactooligosaccharide ABC transporter, permease component 2
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD