Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog BL0185 - Bifidobacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Carbohydrate metabolism
Effector:
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 28 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bifidobacterium longum subsp. infantis ATCC 15697
Bifidobacterium adolescentis ATCC 15703 6 3
Bifidobacterium angulatum DSM 20098 6 3
Bifidobacterium animalis subsp. lactis AD011
Bifidobacterium bifidum NCIMB 41171
Bifidobacterium breve DSM 20213
Bifidobacterium dentium Bd1 8 4
Bifidobacterium gallicum DSM 20093
Bifidobacterium longum NCC2705 9 5
Gardnerella vaginalis 409-05
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
BDP_0236
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
*
Bifidobacterium dentium Bd1

Site:
position = -58
score = 6.08395
sequence = ATATTACAACGTTGTACAAA

Site:
position = -83
score = 5.35762
sequence = CATTTACAACGATGTACTAT

Gene: BDP_0236: Glycoside hydrolase, family 43
 
Bifidobacterium gallicum DSM 20093
*
Bifidobacterium longum NCC2705

Site:
position = -62
score = 5.97869
sequence = AGTTTACATCGTTGTACAAA

Gene: BL0183: Glycoside hydrolase, family 43
 
Gardnerella vaginalis 409-05
Glycoside hydrolase, family 43
BL0182
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705

Gene: BL0182: Glycoside hydrolase, family 43
 
Gardnerella vaginalis 409-05
Glycoside hydrolase, family 43
 
CRON 2.
abfA2
 
Bifidobacterium longum subsp. infantis ATCC 15697
*
Bifidobacterium adolescentis ATCC 15703

Site:
position = -49
score = 4.66833
sequence = TATATTCAACGTTGTAAATA

Site:
position = -72
score = 5.50869
sequence = TTGTTACAACGATGTAAGAA

Gene: BAD_0152: Alpha-L-arabinofuranosidase
*
Bifidobacterium angulatum DSM 20098

Site:
position = -49
score = 4.66833
sequence = TATATTCAACGTTGTAAATA

Site:
position = -72
score = 5.56175
sequence = TTGTTACAACGTTGTAAGAA

Gene: BIFANG_01258: Alpha-L-arabinofuranosidase
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
*
Bifidobacterium dentium Bd1

Site:
position = -50
score = 4.50259
sequence = TATATTCAACGTTGTAAATT

Site:
position = -73
score = 5.93895
sequence = TTTGTACAACGATGTAATAG

Gene: BDP_0239: Alpha-L-arabinofuranosidase
 
Bifidobacterium gallicum DSM 20093
*
Bifidobacterium longum NCC2705

Site:
position = -77
score = 5.54588
sequence = TTGTTACATCGTTGTACATC

Site:
position = -53
score = 5.00276
sequence = ATATTGCATCGATGTAAATA

Gene: BL0187: Alpha-L-arabinofuranosidase
 
Gardnerella vaginalis 409-05
Alpha-L-arabinofuranosidase
 
CRON 3.
BIFANG_01259
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
*
Bifidobacterium angulatum DSM 20098

Site:
position = -114
score = 5.11564
sequence = AAATTACAACGTTATAAAAG

Site:
position = -146
score = 5.68366
sequence = CTTGTACAACGATAGAAAAA

Gene: BIFANG_01259: ABC transporter, substrate-binding protein
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
ABC transporter, substrate-binding protein
BIFANG_01260
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098

Gene: BIFANG_01260: ABC-type sugar transporter, permease component
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
ABC-type sugar transporter, permease component
BIFANG_01261
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098

Gene: BIFANG_01261: ABC-type sugar transporter, permease component
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
ABC-type sugar transporter, permease component
 
CRON 4.
BAD_0149
 
Bifidobacterium longum subsp. infantis ATCC 15697
*2
Bifidobacterium adolescentis ATCC 15703

Site:
position = -72
score = 6.27034
sequence = GTTGTACAACGATGTAAAAC

Site:
position = -47
score = 5.92418
sequence = ATAGTACATCGTTGTAAAAC

Gene: BAD_0146: Glycoside hydrolase, family 43

Gene: BAD_0149: Glycoside hydrolase, family 43
*
Bifidobacterium angulatum DSM 20098

Site:
position = -43
score = 4.9777
sequence = ATAATACATCGATGTAAATC

Site:
position = -69
score = 5.96147
sequence = GCTGTACAACGATGTAAAAA

Gene: BIFANG_01256: Glycoside hydrolase, family 43
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
*
Bifidobacterium dentium Bd1

Site:
position = -44
score = 5.35762
sequence = ATAGTACATCGTTGTAAATG

Site:
position = -69
score = 6.08395
sequence = TTTGTACAACGTTGTAATAT

Gene: BDP_0237: Glycoside hydrolase, family 43
 
Bifidobacterium gallicum DSM 20093
*
Bifidobacterium longum NCC2705

Site:
position = -73
score = 5.97869
sequence = TTTGTACAACGATGTAAACT

Gene: BL0184: Glycoside hydrolase, family 43
 
Gardnerella vaginalis 409-05
Glycoside hydrolase, family 43
BL0185
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_0150: Transcriptional regulator of carbohydrate utilization, LacI family
 
Bifidobacterium angulatum DSM 20098

Gene: BIFANG_01257: Transcriptional regulator of carbohydrate utilization, LacI family
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1

Gene: BDP_0238: Transcriptional regulator of carbohydrate utilization, LacI family
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705

Gene: BL0185: Transcriptional regulator of carbohydrate utilization, LacI family
 
Gardnerella vaginalis 409-05
Transcriptional regulator of carbohydrate utilization, LacI family
 
CRON 5.
Blon_2061
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
*
Bifidobacterium dentium Bd1

Site:
position = -170
score = 5.94134
sequence = TTTGTACAACGATAGAAAAA

Gene: BDP_0240: ABC-type sugar transporter, sugar-binding component
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
ABC-type sugar transporter, sugar-binding component
BDP_0241
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1

Gene: BDP_0241: ABC-type sugar transporter, permease component
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
ABC-type sugar transporter, permease component
BDP_0242
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1

Gene: BDP_0242: ABC-type sugar transporter, permease component
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
ABC-type sugar transporter, permease component
BDP_0243
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1

Gene: BDP_0243: Glycosyl hydrolase family 43
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
Glycosyl hydrolase family 43
 
CRON 6.
BL0186
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
*
Bifidobacterium longum NCC2705

Site:
position = -207
score = 5.54588
sequence = GATGTACAACGATGTAACAA

Site:
position = -65
score = 4.72962
sequence = GAATTACAACGTTATAATGA

Site:
position = -231
score = 5.00276
sequence = TATTTACATCGATGCAATAT

Gene: BL0186: possible esterase
 
Gardnerella vaginalis 409-05
possible esterase
 
CRON 7.
BAD_0153
 
Bifidobacterium longum subsp. infantis ATCC 15697
*
Bifidobacterium adolescentis ATCC 15703

Site:
position = -267
score = 4.69328
sequence = AAATTACAACGTTGAAAATA

Site:
position = -299
score = 5.83463
sequence = GTTGTACAACGATAGAAAAA

Gene: BAD_0153: ABC-type sugar transport systems, substrate-binding components
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
*
Bifidobacterium longum NCC2705

Site:
position = -175
score = 4.88295
sequence = GAATTCCAACGTTGTAAACG

Site:
position = -205
score = 6.12966
sequence = TTTGTACAACGATGGAAAAC

Gene: BL0188: ABC-type sugar transport systems, substrate-binding components
 
Gardnerella vaginalis 409-05
ABC-type sugar transport systems, substrate-binding components
BAD_0154
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_0154: ABC-type sugar transport systems, permease components
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705

Gene: BL0189: ABC-type sugar transport systems, permease components
 
Gardnerella vaginalis 409-05
ABC-type sugar transport systems, permease components
BAD_0155
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_0155: ABC-type sugar transport systems, permease components
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705

Gene: BL0190: ABC-type sugar transport systems, permease components
 
Gardnerella vaginalis 409-05
ABC-type sugar transport systems, permease components
bglS
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703

Gene: BAD_0156: Beta-glucosidase (EC 3.2.1.21)
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
Beta-glucosidase (EC 3.2.1.21)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD