Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog BLA_0143 - Bifidobacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Carbohydrate metabolism
Effector:
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 11 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bifidobacterium longum subsp. infantis ATCC 15697 1 1
Bifidobacterium adolescentis ATCC 15703
Bifidobacterium angulatum DSM 20098 1 1
Bifidobacterium animalis subsp. lactis AD011 4 3
Bifidobacterium bifidum NCIMB 41171
Bifidobacterium breve DSM 20213
Bifidobacterium dentium Bd1 10 6
Bifidobacterium gallicum DSM 20093
Bifidobacterium longum NCC2705
Gardnerella vaginalis 409-05
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
BLA_0143
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
*
Bifidobacterium angulatum DSM 20098

Site:
position = -41
score = 4.25052
sequence = TGGCTGAAGCGCTTCTTGCA

Gene: BIFANG_00310: Transcriptional regulator, LacI family
 
Bifidobacterium animalis subsp. lactis AD011

Gene: BLA_0143: Transcriptional regulator, LacI family
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
*
Bifidobacterium dentium Bd1

Site:
position = -44
score = 5.10123
sequence = TTAAGTAATCGCTTAAGTTC

Gene: BDP_0129: Transcriptional regulator, LacI family
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
Transcriptional regulator, LacI family
 
CRON 2.
BDP_0125
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
*
Bifidobacterium dentium Bd1

Site:
position = -162
score = 5.38385
sequence = CAACTTAAGCGCTTGACAAA

Gene: BDP_0125: ABC transport system, sugar-binding component
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
ABC transport system, sugar-binding component
BDP_0126
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1

Gene: BDP_0126: ABC-type sugar transport system, permease component
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
ABC-type sugar transport system, permease component
BDP_0127
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1

Gene: BDP_0127: ABC-type sugar transport system, permease component
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
ABC-type sugar transport system, permease component
bmnA
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
*
Bifidobacterium animalis subsp. lactis AD011

Site:
position = -134
score = 5.55524
sequence = GAACTTAAGCGCTTGATAAA

Gene: BLA_0142: Beta-mannosidase (EC 3.2.1.25)
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1

Gene: BDP_0128: Beta-mannosidase (EC 3.2.1.25)
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
Beta-mannosidase (EC 3.2.1.25)
 
CRON 3.
nanE-II
 
Bifidobacterium longum subsp. infantis ATCC 15697

Gene: Blon_0875: N-acylglucosamine 2-epimerase (EC 5.1.3.8)
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
*
Bifidobacterium animalis subsp. lactis AD011

Site:
position = -199
score = 5.66026
sequence = CGACTTAAGCGCTTCAGTGA

Gene: BLA_0147: N-acylglucosamine 2-epimerase (EC 5.1.3.8)
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213

Gene: BIFBRE_01537: N-acylglucosamine 2-epimerase (EC 5.1.3.8)
*
Bifidobacterium dentium Bd1

Site:
position = -88
score = 5.69602
sequence = TGCATTAACCGCTTAAGTGA

Gene: BDP_1538: N-acylglucosamine 2-epimerase (EC 5.1.3.8)
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705

Gene: BL1337: N-acylglucosamine 2-epimerase (EC 5.1.3.8)
 
Gardnerella vaginalis 409-05
N-acylglucosamine 2-epimerase (EC 5.1.3.8)
 
CRON 4.
SSF53850
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
*
Bifidobacterium animalis subsp. lactis AD011

Site:
position = -224
score = 5.93786
sequence = TATATTAAGCGGTTAAGTCA

Gene: BLA_0145: Periplasmic binding protein-like II superfamily
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
*
Bifidobacterium dentium Bd1

Site:
position = -98
score = 5.99179
sequence = TATATTAAGCGCTTAAGTAG

Gene: BDP_0133: Periplasmic binding protein-like II superfamily
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
Periplasmic binding protein-like II superfamily
PF04854
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011

Gene: BLA_0144: Protein of unknown function, DUF624
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1

Gene: BDP_0132: Protein of unknown function, DUF624
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
Protein of unknown function, DUF624
 
CRON 5.
bglA
*
Bifidobacterium longum subsp. infantis ATCC 15697

Site:
position = -161
score = 4.97743
sequence = CGACTTAACCGCTTCAGATT

Gene: Blon_1905: Beta-glucosidase (EC 3.2.1.21)
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011

Gene: BLA_0141: Beta-glucosidase (EC 3.2.1.21)
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
*
Bifidobacterium dentium Bd1

Site:
position = -30
score = 5.69809
sequence = TATCTTAACCGCTTCAGGAA

Gene: BDP_0124: Beta-glucosidase (EC 3.2.1.21)
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
Beta-glucosidase (EC 3.2.1.21)
 
CRON 6.
BDP_0134
 
Bifidobacterium longum subsp. infantis ATCC 15697
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
*
Bifidobacterium dentium Bd1

Site:
position = -110
score = 5.99179
sequence = CTACTTAAGCGCTTAATATA

Gene: BDP_0134: alpha-galactosidase
 
Bifidobacterium gallicum DSM 20093
 
Bifidobacterium longum NCC2705
 
Gardnerella vaginalis 409-05
alpha-galactosidase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD