Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog AbfR - Bifidobacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Arabinose oligosaccharide utilization
Effector:
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bifidobacterium adolescentis ATCC 15703
Bifidobacterium angulatum DSM 20098
Bifidobacterium animalis subsp. lactis AD011 2 1
Bifidobacterium bifidum NCIMB 41171
Bifidobacterium breve DSM 20213
Bifidobacterium dentium Bd1
Bifidobacterium gallicum DSM 20093
Bifidobacterium longum NCC2705 3 2
Gardnerella vaginalis 409-05
Bifidobacterium longum subsp. infantis ATCC 15697
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
abfA
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
*
Bifidobacterium animalis subsp. lactis AD011

Site:
position = -113
score = 6.55606
sequence = GAAGTACAAGGTTGTACTAG

Gene: BLA_0055: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213
 
Bifidobacterium dentium Bd1

Gene: BDP_0658: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
 
Bifidobacterium gallicum DSM 20093
*3
Bifidobacterium longum NCC2705

Site:
position = -131
score = 6.55606
sequence = TCAGTACAAGGTTGTACTAC

Gene: BL0544: Alpha-N-arabinofuranosidase (EC 3.2.1.55)

Site:
position = -153
score = 6.39572
sequence = GAAGTACAAGGTTGTATTAA

Gene: BL1611: Alpha-N-arabinofuranosidase (EC 3.2.1.55)

Gene: BL1166: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
 
Gardnerella vaginalis 409-05
 
Bifidobacterium longum subsp. infantis ATCC 15697
Alpha-N-arabinofuranosidase (EC 3.2.1.55)
abfR
 
Bifidobacterium adolescentis ATCC 15703
 
Bifidobacterium angulatum DSM 20098
 
Bifidobacterium animalis subsp. lactis AD011

Gene: BLA_0054: Transcriptional regulator of arabinofuranosidase, LacI family
 
Bifidobacterium bifidum NCIMB 41171
 
Bifidobacterium breve DSM 20213

Gene: BIFBRE_00307: Transcriptional regulator of arabinofuranosidase, LacI family
 
Bifidobacterium dentium Bd1
 
Bifidobacterium gallicum DSM 20093
 2
Bifidobacterium longum NCC2705

Gene: BL0543: Transcriptional regulator of arabinofuranosidase, LacI family

Gene: BL1613: Transcriptional regulator of arabinofuranosidase, LacI family
 
Gardnerella vaginalis 409-05
 
Bifidobacterium longum subsp. infantis ATCC 15697
Transcriptional regulator of arabinofuranosidase, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD