Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog FruR - Staphylococcaceae

Properties
Regulator type: Transcription factor
Regulator family: DeoR
Regulation mode: repressor
Biological process: Fructose utilization
Effector: Fructose-6-phosphate
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 18 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Staphylococcus aureus subsp. aureus N315 3 1
Staphylococcus capitis SK14 3 1
Staphylococcus epidermidis ATCC 12228 3 1
Staphylococcus carnosus subsp. carnosus TM300 3 1
Staphylococcus haemolyticus JCSC1435 3 1
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 3 1
Macrococcus caseolyticus JCSC5402 3 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
fruR
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -83
score = 4.8958
sequence = TGGGTGTTTGTGATTGTTTT

Site:
position = -73
score = 5.33339
sequence = TGATTGTTTTTGGTAATTTA

Site:
position = -63
score = 5.57257
sequence = TGGTAATTTATGATTGAAAA

Gene: SA0653: Transcriptional repressor of the fructose operon, DeoR family
*
Staphylococcus capitis SK14

Site:
position = -76
score = 5.44359
sequence = TGATTGTTTGTGATAATTTA

Site:
position = -66
score = 5.87857
sequence = TGATAATTTATGATTGAAAA

Site:
position = -86
score = 5.66615
sequence = TGAATGTTTTTGATTGTTTG

Gene: STACA0001_0331: Transcriptional repressor of the fructose operon, DeoR family
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -88
score = 6.40895
sequence = TGATTGTTTTTGATTGAAAA

Site:
position = -68
score = 5.45428
sequence = TGGAAGATTTTGATTGAAAT

Gene: SE0470: Transcriptional repressor of the fructose operon, DeoR family
*
Staphylococcus carnosus subsp. carnosus TM300

Site:
position = -84
score = 6.18669
sequence = TGATTGTTTTTGAATGAAAA

Site:
position = -64
score = 5.92443
sequence = TGAAAGATTTTGATTGAAAA

Gene: Sca_0346: Transcriptional repressor of the fructose operon, DeoR family
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -65
score = 5.68701
sequence = TGACAATTTGTGATTGAAAA

Site:
position = -75
score = 5.10622
sequence = TGATTGTTTTTGACAATTTG

Site:
position = -85
score = 5.76712
sequence = TGAATGTTTTTGATTGTTTT

Gene: SH2196: Transcriptional repressor of the fructose operon, DeoR family
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -84
score = 5.7237
sequence = TGACTGTTTTTGATTGTTTT

Site:
position = -74
score = 5.55772
sequence = TGATTGTTTTTGACGAAAAA

Gene: SSP2019: Transcriptional repressor of the fructose operon, DeoR family
*
Macrococcus caseolyticus JCSC5402

Site:
position = -88
score = 4.95686
sequence = TCTCTTTTTTTGATTGTAAA

Site:
position = -78
score = 4.98264
sequence = TGATTGTAAATGAATGAATT

Site:
position = -68
score = 4.91797
sequence = TGAATGAATTTGGTTGACAT

Gene: MCCL_0452: Transcriptional repressor of the fructose operon, DeoR family
Transcriptional repressor of the fructose operon, DeoR family
fruB
 
Staphylococcus aureus subsp. aureus N315

Gene: SA0654: 1-phosphofructokinase (EC 2.7.1.56)
 
Staphylococcus capitis SK14

Gene: STACA0001_0330: 1-phosphofructokinase (EC 2.7.1.56)
 
Staphylococcus epidermidis ATCC 12228

Gene: SE0471: 1-phosphofructokinase (EC 2.7.1.56)
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_0347: 1-phosphofructokinase (EC 2.7.1.56)
 
Staphylococcus haemolyticus JCSC1435

Gene: SH2195: 1-phosphofructokinase (EC 2.7.1.56)
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP2018: 1-phosphofructokinase (EC 2.7.1.56)
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_0453: 1-phosphofructokinase (EC 2.7.1.56)
1-phosphofructokinase (EC 2.7.1.56)
fruA
 
Staphylococcus aureus subsp. aureus N315

Gene: SA0655: PTS system, fructose-specific IIA component (EC 2.7.1.69) / PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69)
 
Staphylococcus capitis SK14

Gene: STACA0001_0329: PTS system, fructose-specific IIA component (EC 2.7.1.69) / PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69)
 
Staphylococcus epidermidis ATCC 12228

Gene: SE0472: PTS system, fructose-specific IIA component (EC 2.7.1.69) / PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69)
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_0348: PTS system, fructose-specific IIA component (EC 2.7.1.69) / PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69)
 
Staphylococcus haemolyticus JCSC1435

Gene: SH2194: PTS system, fructose-specific IIA component (EC 2.7.1.69) / PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69)
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP2017: PTS system, fructose-specific IIA component (EC 2.7.1.69) / PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69)
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_0454: PTS system, fructose-specific IIA component (EC 2.7.1.69) / PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69)
PTS system, fructose-specific IIA component (EC 2.7.1.69) / PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD