Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CzrA - Staphylococcaceae

Properties
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Zinc resistance
Effector: Zinc ion, (Zn2+)
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Staphylococcus aureus subsp. aureus N315 2 1
Staphylococcus capitis SK14 2 1
Staphylococcus epidermidis ATCC 12228 2 1
Staphylococcus carnosus subsp. carnosus TM300 2 1
Staphylococcus haemolyticus JCSC1435 2 1
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 2 1
Macrococcus caseolyticus JCSC5402
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
czrA
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -40
score = 7.33318
sequence = AATATATGAACAAATATTCATATGAA

Gene: SA1947: zinc resistance repressor
*
Staphylococcus capitis SK14

Site:
position = -39
score = 7.5655
sequence = AATATATGAACAAATATTCATATAAA

Gene: STACA0001_0851: zinc resistance repressor
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -21
score = 7.68817
sequence = AATATATGAACAAATATTCATATGTT

Gene: SE1746: zinc resistance repressor
*
Staphylococcus carnosus subsp. carnosus TM300

Site:
position = -45
score = 7.54919
sequence = TATATATGAATAGTTGTTCATATATT

Gene: Sca_1651: zinc resistance repressor
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -41
score = 7.98352
sequence = AATATATGAACATATATTCATATATT

Gene: SH0889: zinc resistance repressor
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -52
score = 7.92048
sequence = AATATATGAACAAATATTCATATATT

Gene: SSP0736: zinc resistance repressor
 
Macrococcus caseolyticus JCSC5402
zinc resistance repressor
czrB
 
Staphylococcus aureus subsp. aureus N315

Gene: SA1948: zinc resistance efflux pump
 
Staphylococcus capitis SK14

Gene: STACA0001_0852: zinc resistance efflux pump
 
Staphylococcus epidermidis ATCC 12228

Gene: SE1747: zinc resistance efflux pump
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_1652: zinc resistance efflux pump
 
Staphylococcus haemolyticus JCSC1435

Gene: SH0888: zinc resistance efflux pump
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP0735: zinc resistance efflux pump
 
Macrococcus caseolyticus JCSC5402
zinc resistance efflux pump
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD